e.g. 1:1246..9423
SNP Detail For snp_cf0001000624877    [See in GBrowse]
1.General Information
SNP ID: snp_cf0001000624877
Organism: Canis familiaris
Individual: solidGW1
Create time: 2014-08-01
Last update: 2014-08-01
2.Allele Information
Platform: SOLiD
Method: sequence
SNP Class: snp
Genotype: C
5'flank: GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC
3'flank: GGCCCCACGCGGTACGCGAGCACCGAGGTC
3.Reference Map information
Chrom Position Reference solidGW1
Chr19 877770 G C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003624 51095 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000005827 234 CCG => CCC ENSCAFP00000005396 78 P => P
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0016001424453 DQ8 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0061001448274 TM2 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0013001367536 DQ5 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0024001147659 GS10 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0042001479302 KM7 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0067001396741 TM8 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0073001412350 YJ4 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0015001423056 DQ7 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0009001426446 DQ1 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0028001057571 GS4 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0040001265924 KM5 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0068001379979 TM9 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0071001457010 YJ2 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0033001112680 GS9 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0036001111616 KM1 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0055001787692 LUPWCHN00001 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0008001416533 DQ10 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0027001110043 GS3 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0017001435946 DQ9 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0069001472610 YJ10 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0032001089909 GS8 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0066001455813 TM7 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0030001109103 GS6 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0070001507116 YJ1 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
snp_cf0039001163007 KM4 C GCAGGTCTCGGTGGCCCAGCCCGCCGCGCC GGCCCCACGCGGTACGCGAGCACCGAGGTC 2014-07-19 2014-07-19
6.Fasta Information
CGAGAGCCCA AGGCGGTGGT GCAGGTCTCG GTGGCCCAGC CCGCCGCGCC
C
GGCCCCACGC GGTACGCGAG CACCGAGGTC GTGGAGGTGA GTGCGCCCGC