e.g. 1:1246..9423
SNP Detail For snp_cf0001000624894    [See in GBrowse]
1.General Information
SNP ID: snp_cf0001000624894
Organism: Canis familiaris
Individual: solidGW1
Create time: 2014-08-01
Last update: 2014-08-01
2.Allele Information
Platform: SOLiD
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: TATCCCATCTATGAGGAGACCAAGATAAAG
3'flank: TGACGGTCTATGATGTCAAGGACAAGGCTC
3.Reference Map information
Chrom Position Reference solidGW1
Chr19 880216 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003624 53541 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000005827 349 CTG => TTG ENSCAFP00000005396 117 L => L
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0054001268616 LJ9 Y TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0044001258284 KM9 Y TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0008001416545 DQ10 Y TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0076001471707 YJ7 Y TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0050001320642 LJ5 Y TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0046001318664 LJ1 Y TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0066001455825 TM7 Y TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0060001421657 TM1 T TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0017001435959 DQ9 Y TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0078001453749 YJ9 Y TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0053001384474 LJ8 Y TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0063001405446 TM4 Y TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0069001472624 YJ10 Y TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0067001396754 TM8 Y TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0061001448286 TM2 T TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0016001424466 DQ8 Y TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0064001434498 TM5 Y TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0065001402430 TM6 Y TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0022001285762 FAMICHN00002 Y TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0009001426458 DQ1 Y TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0021001353566 FAMICHN00001 Y TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0055001787703 LUPWCHN00001 Y TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0012001421479 DQ4 Y TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0062001437551 TM3 T TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
snp_cf0014001410888 DQ6 T TATCCCATCTATGAGGAGACCAAGATAAAG TGACGGTCTATGATGTCAAGGACAAGGCTC 2014-07-19 2014-07-19
6.Fasta Information
GGGTCACCTT CCCGTCCGAG TATCCCATCT ATGAGGAGAC CAAGATAAAG
Y
TGACGGTCTA TGATGTCAAG GACAAGGCTC ATGACACCGT AAGTACTTGC