e.g. 1:1246..9423
SNP Detail For snp_cf0001000625079    [See in GBrowse]
1.General Information
SNP ID: snp_cf0001000625079
Organism: Canis familiaris
Individual: solidGW1
Create time: 2014-08-01
Last update: 2014-08-01
2.Allele Information
Platform: SOLiD
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: GCCCCCGACGGTGGGAGCGGGAAAGAGAAC
3'flank: TGCCCTTCCTGAATGCAGGTACGTGTCTCG
3.Reference Map information
Chrom Position Reference solidGW1
Chr19 997313 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003624 170638 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000005827 685 CTG => TTG ENSCAFP00000005396 229 L => L
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0047001376610 LJ2 Y GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0038001107489 KM3 T GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0015001423393 DQ7 Y GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0073001412697 YJ4 Y GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0011001448616 DQ3 T GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0021001353851 FAMICHN00001 Y GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0071001457352 YJ2 Y GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0041001428918 KM6 Y GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0037001206277 KM2 T GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0075001460646 YJ6 Y GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0053001384752 LJ8 T GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0044001258576 KM9 Y GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0069001472926 YJ10 Y GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0048001350416 LJ3 T GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0039001163199 KM4 T GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0010001406372 DQ2 T GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0055001788001 LUPWCHN00001 Y GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0036001111809 KM1 T GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0070001507461 YJ1 Y GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0042001479638 KM7 Y GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0074001443548 YJ5 Y GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0013001367728 DQ5 T GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0077001444309 YJ8 Y GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0018001199305 FAMBBEM00001 Y GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0051001423526 LJ6 T GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0023001330043 FAMICHN00003 Y GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0049001441041 LJ4 T GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0004001189398 Basenji Y GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
snp_cf0016001424759 DQ8 Y GCCCCCGACGGTGGGAGCGGGAAAGAGAAC TGCCCTTCCTGAATGCAGGTACGTGTCTCG 2014-07-19 2014-07-19
6.Fasta Information
CGCTGGTGTG TGAATGTGCA GCCCCCGACG GTGGGAGCGG GAAAGAGAAC
Y
TGCCCTTCCT GAATGCAGGT ACGTGTCTCG GGGTGGGAGC CTCCCGCTCG