e.g. 1:1246..9423
SNP Detail For snp_cf0001000625605    [See in GBrowse]
1.General Information
SNP ID: snp_cf0001000625605
Organism: Canis familiaris
Individual: solidGW1
Create time: 2014-08-01
Last update: 2014-08-01
2.Allele Information
Platform: SOLiD
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: GCAGGACGGAGAGGTCGTCTTTACCGCCAA
3'flank: GGTAAGTGCTCGGCCCGGACGCGCCGGGGC
3.Reference Map information
Chrom Position Reference solidGW1
Chr19 2014821 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000028804 197620 + T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000044982 1029 AAT => AAC ENSCAFP00000038311 343 N => N
+ ENSCAFT00000043654 924 AAT => AAC ENSCAFP00000035985 308 N => N
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0055001789018 LUPWCHN00001 Y GCAGGACGGAGAGGTCGTCTTTACCGCCAA GGTAAGTGCTCGGCCCGGACGCGCCGGGGC 2014-07-19 2014-07-19
6.Fasta Information
CCGGACGCGG AGCCCACCCC GCAGGACGGA GAGGTCGTCT TTACCGCCAA
Y
GGTAAGTGCT CGGCCCGGAC GCGCCGGGGC GCACAGGGTG GTTGGCACAC