e.g. 1:1246..9423
SNP Detail For snp_cf0001000625765    [See in GBrowse]
1.General Information
SNP ID: snp_cf0001000625765
Organism: Canis familiaris
Individual: solidGW1
Create time: 2014-08-01
Last update: 2014-08-01
2.Allele Information
Platform: SOLiD
Method: sequence
SNP Class: snp
Genotype: C
5'flank: GGACCGGCACGACCCCAGCCTGCCTTACCT
3'flank: GAACAGTATCGCATTGACTTTGAGCAGTTC
3.Reference Map information
Chrom Position Reference solidGW1
Chr19 2244605 G C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003662 101617 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000047686 2583 CTG => CTC ENSCAFP00000039298 861 L => L
+ ENSCAFT00000048876 2577 CTG => CTC ENSCAFP00000038259 859 L => L
+ ENSCAFT00000005903 2457 CTG => CTC ENSCAFP00000005467 819 L => L
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0005001737952 CHW S GGACCGGCACGACCCCAGCCTGCCTTACCT GAACAGTATCGCATTGACTTTGAGCAGTTC 2014-07-19 2014-07-19
snp_cf0058001792719 LUPWRUS00003 S GGACCGGCACGACCCCAGCCTGCCTTACCT GAACAGTATCGCATTGACTTTGAGCAGTTC 2014-07-19 2014-07-19
snp_cf0057001720642 LUPWRUS00002 C GGACCGGCACGACCCCAGCCTGCCTTACCT GAACAGTATCGCATTGACTTTGAGCAGTTC 2014-07-19 2014-07-19
snp_cf0035001376811 KM10 S GGACCGGCACGACCCCAGCCTGCCTTACCT GAACAGTATCGCATTGACTTTGAGCAGTTC 2014-07-19 2014-07-19
snp_cf0055001789203 LUPWCHN00001 S GGACCGGCACGACCCCAGCCTGCCTTACCT GAACAGTATCGCATTGACTTTGAGCAGTTC 2014-07-19 2014-07-19
snp_cf0004001191320 Basenji S GGACCGGCACGACCCCAGCCTGCCTTACCT GAACAGTATCGCATTGACTTTGAGCAGTTC 2014-07-19 2014-07-19
snp_cf0043001193785 KM8 S GGACCGGCACGACCCCAGCCTGCCTTACCT GAACAGTATCGCATTGACTTTGAGCAGTTC 2014-07-19 2014-07-19
6.Fasta Information
GGCGGGAGCA GCAACGCGCT GGACCGGCAC GACCCCAGCC TGCCTTACCT
C
GAACAGTATC GCATTGACTT TGAGCAGTTC AAGGGCATGT TTGCTCTCCT