e.g. 1:1246..9423
SNP Detail For snp_cf0001000625794    [See in GBrowse]
1.General Information
SNP ID: snp_cf0001000625794
Organism: Canis familiaris
Individual: solidGW1
Create time: 2014-08-01
Last update: 2014-08-01
2.Allele Information
Platform: SOLiD
Method: sequence
SNP Class: snp
Genotype: C
5'flank: CGTTGGCGCCATCCCCAGGCCTGTGACCCG
3'flank: GCCTCTCCTCTCCAGATCCAAGGGGAAGGC
3.Reference Map information
Chrom Position Reference solidGW1
Chr19 2282611 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003684 56 + T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000005925 6 CGT => CGC ENSCAFP00000005489 2 R => R
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0073001414916 YJ4 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0027001111067 GS3 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0043001193846 KM8 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0056001807508 LUPWRUS00001 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0068001381244 TM9 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0072001467277 YJ3 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0030001110128 GS6 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0015001425846 DQ7 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0078001456614 YJ9 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0007001222017 Dingo C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0063001407767 TM4 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0066001458438 TM7 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0009001429251 DQ1 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0029001044733 GS5 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0052001395209 LJ7 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0016001427311 DQ8 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0005001738006 CHW C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0031001109361 GS7 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0071001459171 YJ2 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0024001148679 GS10 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0041001430799 KM6 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0075001462358 YJ6 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0044001261305 KM9 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0057001720684 LUPWRUS00002 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0017001438521 DQ9 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0010001408089 DQ2 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0039001164735 KM4 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0023001331677 FAMICHN00003 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0065001405230 TM6 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0059001425465 TM10 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0011001450106 DQ3 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0032001090932 GS8 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0055001789246 LUPWCHN00001 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0036001113522 KM1 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0025001105953 GS1 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0013001369218 DQ5 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0008001418847 DQ10 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0021001356285 FAMICHN00001 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0061001450391 TM2 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0038001109220 KM3 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0035001376874 KM10 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0060001423675 TM1 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0076001474314 YJ7 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0014001412897 DQ6 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0070001509421 YJ1 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0033001113699 GS9 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0077001446378 YJ8 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0049001442721 LJ4 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0042001481613 KM7 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0074001445689 YJ5 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0006001660483 CRW C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0067001398952 TM8 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0019001097896 FAMBGSD00001 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0069001476021 YJ10 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0028001058588 GS4 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0064001436991 TM5 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0012001424227 DQ4 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0037001207771 KM2 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0026001099089 GS2 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0040001266949 KM5 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0020001415334 FAMBTIM00001 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
snp_cf0062001439657 TM3 C CGTTGGCGCCATCCCCAGGCCTGTGACCCG GCCTCTCCTCTCCAGATCCAAGGGGAAGGC 2014-07-19 2014-07-19
6.Fasta Information
CAACGAGCCA CTCCTCGCGT CGTTGGCGCC ATCCCCAGGC CTGTGACCCG
C
GCCTCTCCTC TCCAGATCCA AGGGGAAGGC CAGGGCCAGC CCCCCAGGGC