e.g. 1:1246..9423
SNP Detail For snp_cf0001000625871    [See in GBrowse]
1.General Information
SNP ID: snp_cf0001000625871
Organism: Canis familiaris
Individual: solidGW1
Create time: 2014-08-01
Last update: 2014-08-01
2.Allele Information
Platform: SOLiD
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: CAGCGCCGGCCGCCACCTGCCCTCGCCGCC
3'flank: ACCTGCCCTCGCGGCCCACCTGCCCTCGCA
3.Reference Map information
Chrom Position Reference solidGW1
Chr19 2584235 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000028984 1436 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000043842 1436 CCA => CTA ENSCAFP00000037018 479 P => L
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
NA NA NA NA NA NA NA
6.Fasta Information
CTGCTGCACA GCGCGGGGAG CAGCGCCGGC CGCCACCTGC CCTCGCCGCC
Y
ACCTGCCCTC GCGGCCCACC TGCCCTCGCA GCCCACCTAC CCTCGGTGCG