e.g. 1:1246..9423
SNP Detail For snp_cf0001000627186    [See in GBrowse]
1.General Information
SNP ID: snp_cf0001000627186
Organism: Canis familiaris
Individual: solidGW1
Create time: 2014-08-01
Last update: 2014-08-01
2.Allele Information
Platform: SOLiD
Method: sequence
SNP Class: snp
Genotype: A
5'flank: TGCCAGAGAATTTCTCCCTAGAGCTCACCC
3'flank: TGCCACTCCGGCTGTTGAGGTAAGATCATT
3.Reference Map information
Chrom Position Reference solidGW1
Chr19 4970312 C A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003758 2380 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000006044 2264 CCT => CAT ENSCAFP00000005600 755 P => H
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0023001333570 FAMICHN00003 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0007001225094 Dingo A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0045001283757 LJ10 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0004001194627 Basenji A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0012001427672 DQ4 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0072001469571 YJ3 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0073001417027 YJ4 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0057001725067 LUPWRUS00002 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0077001450189 YJ8 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0056001812658 LUPWRUS00001 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0048001354830 LJ3 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0068001383948 TM9 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0054001273787 LJ9 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0069001478567 YJ10 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0076001477206 YJ7 M TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0032001092800 GS8 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0025001107806 GS1 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0009001432156 DQ1 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0029001046595 GS5 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0070001512112 YJ1 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0055001793213 LUPWCHN00001 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0006001665673 CRW A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0016001430903 DQ8 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0060001426283 TM1 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0038001112842 KM3 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0075001465546 YJ6 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0026001100947 GS2 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0030001111987 GS6 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0042001485714 KM7 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0065001408143 TM6 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0034001689806 ISW A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0052001396897 LJ7 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0050001327085 LJ5 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0049001445103 LJ4 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0028001060444 GS4 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0051001427583 LJ6 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0022001290369 FAMICHN00002 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0021001358947 FAMICHN00001 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0041001434845 KM6 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0039001167047 KM4 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0031001111216 GS7 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0005001743306 CHW A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0036001117189 KM1 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0008001420888 DQ10 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0002000941447 CID1 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-08-02 2014-08-02
snp_cf0044001264643 KM9 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0066001461111 TM7 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0027001112929 GS3 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0053001389863 LJ8 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0064001439799 TM5 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0010001412045 DQ2 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0046001323289 LJ1 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0043001198352 KM8 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0062001443081 TM3 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0059001426983 TM10 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0033001115551 GS9 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0067001402028 TM8 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0047001381942 LJ2 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0017001441111 DQ9 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0058001798000 LUPWRUS00003 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0074001449168 YJ5 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0014001415500 DQ6 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0013001371288 DQ5 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0063001411303 TM4 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0071001461984 YJ2 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0019001099758 FAMBGSD00001 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0015001428807 DQ7 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0040001268807 KM5 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0018001204334 FAMBBEM00001 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0035001381756 KM10 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0037001209956 KM2 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0078001458227 YJ9 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0011001451251 DQ3 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0024001150535 GS10 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0020001418726 FAMBTIM00001 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
snp_cf0061001453813 TM2 A TGCCAGAGAATTTCTCCCTAGAGCTCACCC TGCCACTCCGGCTGTTGAGGTAAGATCATT 2014-07-19 2014-07-19
6.Fasta Information
GACCATCTCG TCCAACCACG TGCCAGAGAA TTTCTCCCTA GAGCTCACCC
A
TGCCACTCCG GCTGTTGAGG TAAGATCATT CTCTGCATCC CTTCACCGAC