e.g. 1:1246..9423
SNP Detail For snp_cf0001000000007    [See in GBrowse]
1.General Information
SNP ID: snp_cf0001000000007
Organism: Canis familiaris
Individual: solidGW1
Create time: 2014-08-01
Last update: 2014-08-01
2.Allele Information
Platform: SOLiD
Method: sequence
SNP Class: snp
Genotype: R
5'flank: GCATGCTTCCCTTTGAGAGCTGAGGACAGG
3'flank: CAGAACCCTCCCGCATCCTGCCTGACTGTA
3.Reference Map information
Chrom Position Reference solidGW1
Chr1 1882 A R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
NA NA NA NA NA NA NA
6.Fasta Information
AGTTGAGAGC TGGCTTCTAG GCATGCTTCC CTTTGAGAGC TGAGGACAGG
R
CAGAACCCTC CCGCATCCTG CCTGACTGTA GACGTACCTG CTAACCTCCT