e.g. 1:1246..9423
SNP Detail For snp_cf0010000370418    [See in GBrowse]
1.General Information
SNP ID: snp_cf0010000370418
Organism: Canis familiaris
Individual: DQ2
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: GCTCACACCCTTGCGGCCAAAGGTCATCGT
3'flank: CTGGAGATCTCAGGCCGCACACAGGCCCTG
3.Reference Map information
Chrom Position Reference DQ2
Chr11 116125 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000012938 936 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000020534 936 AGA => AGG ENSCAFP00000019057 312 R => R
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0051000364776 LJ6 Y GCTCACACCCTTGCGGCCAAAGGTCATCGT CTGGAGATCTCAGGCCGCACACAGGCCCTG 2014-07-19 2014-07-19
snp_cf0002000240019 CID1 Y GCTCACACCCTTGCGGCCAAAGGTCATCGT CTGGAGATCTCAGGCCGCACACAGGCCCTG 2014-08-02 2014-08-02
snp_cf0073000381264 YJ4 Y GCTCACACCCTTGCGGCCAAAGGTCATCGT CTGGAGATCTCAGGCCGCACACAGGCCCTG 2014-07-19 2014-07-19
snp_cf0060000375634 TM1 Y GCTCACACCCTTGCGGCCAAAGGTCATCGT CTGGAGATCTCAGGCCGCACACAGGCCCTG 2014-07-19 2014-07-19
snp_cf0075000382588 YJ6 Y GCTCACACCCTTGCGGCCAAAGGTCATCGT CTGGAGATCTCAGGCCGCACACAGGCCCTG 2014-07-19 2014-07-19
snp_cf0012000363050 DQ4 Y GCTCACACCCTTGCGGCCAAAGGTCATCGT CTGGAGATCTCAGGCCGCACACAGGCCCTG 2014-07-19 2014-07-19
snp_cf0034000448083 ISW Y GCTCACACCCTTGCGGCCAAAGGTCATCGT CTGGAGATCTCAGGCCGCACACAGGCCCTG 2014-07-19 2014-07-19
6.Fasta Information
TGGTCAAAGA ACTGCCCATG GCTCACACCC TTGCGGCCAA AGGTCATCGT
Y
CTGGAGATCT CAGGCCGCAC ACAGGCCCTG CCCTGCCGCT GCTCAGGCCT