e.g. 1:1246..9423
SNP Detail For snp_cf0010000370696    [See in GBrowse]
1.General Information
SNP ID: snp_cf0010000370696
Organism: Canis familiaris
Individual: DQ2
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: TCACCTTGCTTCCTGACCAGGTCTTTATTG
3'flank: GCTTCTTATGAAAGTGAGAGCCCAGAGAAC
3.Reference Map information
Chrom Position Reference DQ2
Chr11 1573375 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000391 53987 + A splice_site
ENSCAFG00000000391 53987 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000048461 1320 TGA => TGG ENSCAFP00000036021 440 stop_codon => W
+ ENSCAFT00000047085 1320 TGA => TGG ENSCAFP00000039759 440 stop_codon => W
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0013000375506 DQ5 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0041000347483 KM6 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0053000362875 LJ8 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0054000328259 LJ9 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0008000362722 DQ10 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0009000370283 DQ1 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0030000291842 GS6 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0027000285004 GS3 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0020000366603 FAMBTIM00001 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0062000375509 TM3 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0051000365557 LJ6 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0011000373210 DQ3 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0015000370836 DQ7 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0068000356227 TM9 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0040000310508 KM5 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0022000337273 FAMICHN00002 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0066000376405 TM7 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0059000374177 TM10 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0028000272394 GS4 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0073000382301 YJ4 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0072000381764 YJ3 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0033000302828 GS9 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0052000355245 LJ7 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0046000336448 LJ1 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0014000359826 DQ6 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0019000287176 FAMBGSD00001 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0055000470241 LUPWCHN00001 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0056000475944 LUPWRUS00001 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0018000305151 FAMBBEM00001 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0025000271546 GS1 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0078000381510 YJ9 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0071000374708 YJ2 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0075000383399 YJ6 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0076000380290 YJ7 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0016000371658 DQ8 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0070000390445 YJ1 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0047000343027 LJ2 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0074000375972 YJ5 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0036000298921 KM1 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0057000458831 LUPWRUS00002 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0031000293780 GS7 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0061000374664 TM2 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0035000349560 KM10 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0029000237973 GS5 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0039000288413 KM4 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0044000325390 KM9 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0069000381305 YJ10 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0032000274032 GS8 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0065000351199 TM6 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0064000378191 TM5 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0005000445946 CHW G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0037000314716 KM2 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0077000375618 YJ8 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0024000312800 GS10 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0058000471697 LUPWRUS00003 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0006000427397 CRW G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0034000449625 ISW G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0049000375195 LJ4 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0007000302538 Dingo G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0060000377237 TM1 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0023000340049 FAMICHN00003 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0038000294311 KM3 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0050000331045 LJ5 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0063000370589 TM4 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0042000358973 KM7 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0004000302445 Basenji G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0048000345719 LJ3 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0012000364643 DQ4 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0017000381769 DQ9 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0021000352576 FAMICHN00001 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0067000363251 TM8 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0043000315530 KM8 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0026000286581 GS2 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
snp_cf0045000309473 LJ10 G TCACCTTGCTTCCTGACCAGGTCTTTATTG GCTTCTTATGAAAGTGAGAGCCCAGAGAAC 2014-07-19 2014-07-19
6.Fasta Information
CGCTGACCAT AACTGTAATT TCACCTTGCT TCCTGACCAG GTCTTTATTG
G
GCTTCTTATG AAAGTGAGAG CCCAGAGAAC CAAACAGAAA AAGAGAGGTG