e.g. 1:1246..9423
SNP Detail For snp_cf0010000370744    [See in GBrowse]
1.General Information
SNP ID: snp_cf0010000370744
Organism: Canis familiaris
Individual: DQ2
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: AAGGTAGACCAACCCGCACAGGGCCGCCGT
3'flank: CCTGCGAGAGGGCCGGGGCGGCCACGTGAG
3.Reference Map information
Chrom Position Reference DQ2
Chr11 1894459 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000354 2521 - A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000000553 231 GGT => GGC ENSCAFP00000000503 77 G => G
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0028000272429 GS4 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0014000359875 DQ6 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0052000355292 LJ7 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0076000380362 YJ7 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0075000383503 YJ6 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0069000381449 YJ10 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0027000285048 GS3 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0068000356273 TM9 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0001000194539 solidGW1 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-08-01 2014-08-01
snp_cf0060000377308 TM1 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0062000375867 TM3 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0017000381996 DQ9 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0035000349616 KM10 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0012000364718 DQ4 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0071000374771 YJ2 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0009000370330 DQ1 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0008000362777 DQ10 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0030000291897 GS6 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0013000375557 DQ5 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0016000371976 DQ8 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0026000286636 GS2 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0015000370889 DQ7 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0059000374227 TM10 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0049000375246 LJ4 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0061000374718 TM2 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0041000347546 KM6 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0072000381830 YJ3 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0044000325439 KM9 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0036000298960 KM1 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0065000351248 TM6 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0067000363553 TM8 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0077000375728 YJ8 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0024000312850 GS10 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0025000271597 GS1 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0038000294368 KM3 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0078000381669 YJ9 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0039000288460 KM4 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0070000390557 YJ1 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0033000302885 GS9 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0043000315582 KM8 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0073000382479 YJ4 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0042000359031 KM7 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0029000238011 GS5 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0064000378237 TM5 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0063000370664 TM4 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0032000274087 GS8 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0074000376043 YJ5 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0040000310619 KM5 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0066000376713 TM7 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0011000373269 DQ3 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0031000293816 GS7 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
snp_cf0037000314760 KM2 G AAGGTAGACCAACCCGCACAGGGCCGCCGT CCTGCGAGAGGGCCGGGGCGGCCACGTGAG 2014-07-19 2014-07-19
6.Fasta Information
AAGTAGCGGA GGCGCGCGAA AAGGTAGACC AACCCGCACA GGGCCGCCGT
G
CCTGCGAGAG GGCCGGGGCG GCCACGTGAG CCGCCTGGTG CGCGGCCCGG