e.g. 1:1246..9423
SNP Detail For snp_cf0010000370752    [See in GBrowse]
1.General Information
SNP ID: snp_cf0010000370752
Organism: Canis familiaris
Individual: DQ2
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA
3'flank: GAGCTCCAGGCGCTCGGGCGACACGGCCTC
3.Reference Map information
Chrom Position Reference DQ2
Chr11 1963683 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000350 52811 - T intron
ENSCAFG00000000350 52811 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000038429 154 ATG => GTG ENSCAFP00000034146 52 M => V
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0017000382052 DQ9 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0026000286644 GS2 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0042000359042 KM7 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0040000310665 KM5 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0077000375780 YJ8 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0027000285052 GS3 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0041000347559 KM6 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0032000274095 GS8 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0063000370718 TM4 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0066000376764 TM7 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0065000351257 TM6 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0073000382540 YJ4 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0044000325446 KM9 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0076000380413 YJ7 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0016000372026 DQ8 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0043000315589 KM8 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0075000383558 YJ6 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0039000288467 KM4 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0038000294377 KM3 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0068000356281 TM9 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0049000375253 LJ4 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0072000381839 YJ3 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0033000302893 GS9 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0078000381717 YJ9 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0071000374785 YJ2 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0021000352671 FAMICHN00001 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0070000390605 YJ1 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0036000298964 KM1 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0055000470392 LUPWCHN00001 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0030000291905 GS6 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0031000293820 GS7 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0062000375926 TM3 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0024000312858 GS10 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0060000377368 TM1 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0069000381501 YJ10 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0013000375566 DQ5 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0067000363600 TM8 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0059000374236 TM10 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0020000366709 FAMBTIM00001 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0052000355306 LJ7 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0015000370898 DQ7 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0046000336703 LJ1 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0012000364778 DQ4 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0061000374730 TM2 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0025000271605 GS1 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0029000238015 GS5 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0014000359884 DQ6 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0074000376092 YJ5 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0028000272433 GS4 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0037000314764 KM2 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
snp_cf0035000349623 KM10 C GCTGGTGCAGAGCGAAAGTGTGCTGGCGCA GAGCTCCAGGCGCTCGGGCGACACGGCCTC 2014-07-19 2014-07-19
6.Fasta Information
NNNNNNNNNN NNGATGCAGC GCTGGTGCAG AGCGAAAGTG TGCTGGCGCA
C
GAGCTCCAGG CGCTCGGGCG ACACGGCCTC GTAGCGGGCC TCGCAGGTGC