e.g. 1:1246..9423
SNP Detail For snp_cf0010001288881    [See in GBrowse]
1.General Information
SNP ID: snp_cf0010001288881
Organism: Canis familiaris
Individual: DQ2
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs8883676  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: TAAGATCCCACAAGATCCGGGTGACATTCA
3'flank: GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC
3.Reference Map information
Chrom Position Reference DQ2
Chr18 180806 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003334 24941 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000005349 4842 CAA => CAG ENSCAFP00000004953 1614 Q => Q
+ ENSCAFT00000044856 3276 CAA => CAG ENSCAFP00000038766 1092 Q => Q
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0069001349760 YJ10 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0068001258135 TM9 G TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0040001165170 KM5 G TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0060001300214 TM1 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0051001306484 LJ6 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0050001214358 LJ5 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0025001007575 GS1 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0016001304004 DQ8 G TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0032001009757 GS8 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0005001579994 CHW R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0042001356851 KM7 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0029000944005 GS5 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0075001339903 YJ6 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0011001329246 DQ3 G TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0073001292944 YJ4 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0026001001824 GS2 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0019001006748 FAMBGSD00001 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0056001650516 LUPWRUS00001 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0038001003602 KM3 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0037001102246 KM2 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0028000963777 GS4 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0062001318060 TM3 G TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0072001343581 YJ3 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0067001279547 TM8 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0002000859000 CID1 G TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-08-02 2014-08-02
snp_cf0064001317123 TM5 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0047001265534 LJ2 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0012001303358 DQ4 G TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0066001336223 TM7 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0020001295675 FAMBTIM00001 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0033001016325 GS9 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0063001287811 TM4 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0024001052942 GS10 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0054001168642 LJ9 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0041001311231 KM6 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0009001308337 DQ1 G TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0013001252523 DQ5 G TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0031001014516 GS7 G TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0007001118170 Dingo R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0059001306559 TM10 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0017001318649 DQ9 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0061001325629 TM2 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0052001274164 LJ7 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0003000735617 dbSNP139 G TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0078001336477 YJ9 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0014001292994 DQ6 G TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0027001014836 GS3 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0070001383133 YJ1 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0030001026870 GS6 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
snp_cf0076001349057 YJ7 R TAAGATCCCACAAGATCCGGGTGACATTCA GTTTTCAAGAAGGTAGCTTCTCTCCTGCGC 2014-07-19 2014-07-19
6.Fasta Information
CTGACGCCCT CAGTTCTTCA TAAGATCCCA CAAGATCCGG GTGACATTCA
G
GTTTTCAAGA AGGTAGCTTC TCTCCTGCGC ACTCTCAAGA AGATGGACAT