e.g. 1:1246..9423
SNP Detail For snp_cf0010001288882    [See in GBrowse]
1.General Information
SNP ID: snp_cf0010001288882
Organism: Canis familiaris
Individual: DQ2
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs8883674  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: CACATACTATGTGCTTCCTCATGCCGTGAG
3'flank: CTCCTGCAGAGGGGAGTCGACAAAAACCTC
3.Reference Map information
Chrom Position Reference DQ2
Chr18 181097 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003334 25232 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000005349 5133 AGA => AGG ENSCAFP00000004953 1711 R => R
+ ENSCAFT00000044856 3567 AGA => AGG ENSCAFP00000038766 1189 R => R
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0034001539273 ISW R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0076001349058 YJ7 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0069001349761 YJ10 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0001000557658 solidGW1 G CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-08-01 2014-08-01
snp_cf0040001165171 KM5 G CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0068001258136 TM9 G CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0060001300215 TM1 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0032001009758 GS8 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0050001214359 LJ5 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0005001579995 CHW G CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0025001007576 GS1 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0016001304005 DQ8 G CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0042001356852 KM7 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0075001339904 YJ6 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0029000944006 GS5 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0073001292945 YJ4 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0011001329247 DQ3 G CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0026001001825 GS2 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0057001567411 LUPWRUS00002 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0019001006749 FAMBGSD00001 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0056001650517 LUPWRUS00001 G CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0038001003603 KM3 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0051001306485 LJ6 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0037001102247 KM2 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0028000963778 GS4 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0067001279548 TM8 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0062001318061 TM3 G CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0055001635539 LUPWCHN00001 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0002000859001 CID1 G CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-08-02 2014-08-02
snp_cf0072001343582 YJ3 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0012001303359 DQ4 G CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0047001265535 LJ2 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0020001295676 FAMBTIM00001 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0063001287812 TM4 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0059001306560 TM10 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0033001016326 GS9 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0024001052943 GS10 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0066001336224 TM7 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0054001168643 LJ9 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0013001252524 DQ5 G CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0031001014517 GS7 G CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0009001308338 DQ1 G CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0027001014837 GS3 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0006001514655 CRW G CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0003000735618 dbSNP139 G CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0058001636995 LUPWRUS00003 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0078001336478 YJ9 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0061001325630 TM2 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0014001292995 DQ6 G CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0052001274165 LJ7 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0070001383134 YJ1 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0017001318650 DQ9 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0064001317124 TM5 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
snp_cf0030001026871 GS6 R CACATACTATGTGCTTCCTCATGCCGTGAG CTCCTGCAGAGGGGAGTCGACAAAAACCTC 2014-07-19 2014-07-19
6.Fasta Information
GATGTCAACG CTGTGGTAGA CACATACTAT GTGCTTCCTC ATGCCGTGAG
G
CTCCTGCAGA GGGGAGTCGA CAAAAACCTC ACCGAAGTCC TCAAGGATGT