e.g. 1:1246..9423
SNP Detail For snp_cf0010001288887    [See in GBrowse]
1.General Information
SNP ID: snp_cf0010001288887
Organism: Canis familiaris
Individual: DQ2
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: GAGGGACATCGCTGACATGAGCCATCTTGC
3'flank: GCCTCAGTGACCTCCGCCGTGGAACTTGTG
3.Reference Map information
Chrom Position Reference DQ2
Chr18 185512 A C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003334 29647 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000005349 7383 GCA => GCC ENSCAFP00000004953 2461 A => A
+ ENSCAFT00000044856 5853 GCA => GCC ENSCAFP00000038766 1951 A => A
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0073001292950 YJ4 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0040001165176 KM5 C GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0052001274171 LJ7 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0056001650521 LUPWRUS00001 C GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0029000944011 GS5 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0027001014842 GS3 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0034001539279 ISW C GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0026001001830 GS2 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0068001258142 TM9 C GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0042001356857 KM7 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0076001349063 YJ7 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0001000557662 solidGW1 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-08-01 2014-08-01
snp_cf0055001635545 LUPWCHN00001 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0038001003608 KM3 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0057001567416 LUPWRUS00002 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0075001339909 YJ6 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0020001295683 FAMBTIM00001 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0005001579998 CHW C GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0037001102252 KM2 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0072001343587 YJ3 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0019001006753 FAMBGSD00001 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0062001318067 TM3 C GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0051001306491 LJ6 C GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0002000859007 CID1 C GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-08-02 2014-08-02
snp_cf0009001308344 DQ1 C GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0031001014522 GS7 C GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0011001329253 DQ3 C GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0007001118175 Dingo M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0059001306565 TM10 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0022001179805 FAMICHN00002 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0006001514660 CRW C GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0013001252529 DQ5 C GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0066001336230 TM7 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0024001052948 GS10 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0063001287818 TM4 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0028000963784 GS4 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0067001279553 TM8 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0054001168649 LJ9 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0012001303365 DQ4 C GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0061001325636 TM2 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0047001265540 LJ2 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0064001317130 TM5 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0014001293001 DQ6 C GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0033001016331 GS9 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0070001383139 YJ1 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0060001300223 TM1 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0058001637000 LUPWRUS00003 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0025001007581 GS1 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0030001026877 GS6 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0032001009763 GS8 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0078001336484 YJ9 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0069001349766 YJ10 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0016001304010 DQ8 C GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
snp_cf0017001318656 DQ9 M GAGGGACATCGCTGACATGAGCCATCTTGC GCCTCAGTGACCTCCGCCGTGGAACTTGTG 2014-07-19 2014-07-19
6.Fasta Information
GATACCCTGA CCATGCTGGT GAGGGACATC GCTGACATGA GCCATCTTGC
C
GCCTCAGTGA CCTCCGCCGT GGAACTTGTG GGGCGAGCCC AGAAAGTTGC