e.g. 1:1246..9423
SNP Detail For snp_cf0010001288891    [See in GBrowse]
1.General Information
SNP ID: snp_cf0010001288891
Organism: Canis familiaris
Individual: DQ2
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs8922907  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: CTGGAGTATTTTTAATCTGTCGCTGACATT
3'flank: GCTCAGCATCCAGACCACCTTTTGAAAGCC
3.Reference Map information
Chrom Position Reference DQ2
Chr18 186256 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003334 30391 + T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000005349 8127 TTT => TTC ENSCAFP00000004953 2709 F => F
+ ENSCAFT00000044856 6597 TTT => TTC ENSCAFP00000038766 2199 F => F
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0052001274175 LJ7 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0075001339913 YJ6 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0073001292954 YJ4 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0026001001834 GS2 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0078001336489 YJ9 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0061001325640 TM2 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0056001650525 LUPWRUS00001 C CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0038001003613 KM3 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0029000944015 GS5 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0027001014846 GS3 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0017001318660 DQ9 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0055001635549 LUPWCHN00001 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0001000557664 solidGW1 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-08-01 2014-08-01
snp_cf0076001349067 YJ7 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0024001052952 GS10 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0068001258146 TM9 C CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0040001165181 KM5 C CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0020001295687 FAMBTIM00001 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0051001306495 LJ6 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0009001308348 DQ1 C CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0019001006757 FAMBGSD00001 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0050001214368 LJ5 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0031001014526 GS7 C CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0057001567420 LUPWRUS00002 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0011001329257 DQ3 C CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0059001306569 TM10 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0006001514664 CRW C CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0007001118179 Dingo Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0041001311234 KM6 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0070001383143 YJ1 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0037001102256 KM2 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0028000963788 GS4 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0062001318071 TM3 C CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0072001343591 YJ3 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0067001279557 TM8 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0030001026881 GS6 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0002000859011 CID1 C CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-08-02 2014-08-02
snp_cf0069001349770 YJ10 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0064001317134 TM5 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0058001637004 LUPWRUS00003 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0012001303369 DQ4 C CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0047001265544 LJ2 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0060001300227 TM1 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0014001293005 DQ6 C CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0033001016335 GS9 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0066001336234 TM7 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0063001287822 TM4 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0005001580003 CHW C CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0054001168653 LJ9 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0016001304014 DQ8 C CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0025001007585 GS1 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0032001009767 GS8 Y CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0013001252533 DQ5 C CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
snp_cf0003000735622 dbSNP139 C CTGGAGTATTTTTAATCTGTCGCTGACATT GCTCAGCATCCAGACCACCTTTTGAAAGCC 2014-07-19 2014-07-19
6.Fasta Information
AATGACTTAG AGAAGGACGA CTGGAGTATT TTTAATCTGT CGCTGACATT
C
GCTCAGCATC CAGACCACCT TTTGAAAGCC ATAGAGACAG CTGGAGAGGC