e.g. 1:1246..9423
SNP Detail For snp_cf0010001288955    [See in GBrowse]
1.General Information
SNP ID: snp_cf0010001288955
Organism: Canis familiaris
Individual: DQ2
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC
3'flank: GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG
3.Reference Map information
Chrom Position Reference DQ2
Chr18 195852 C T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003334 39987 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000005349 8874 GCC => GCT ENSCAFP00000004953 2958 A => A
+ ENSCAFT00000044856 7344 GCC => GCT ENSCAFP00000038766 2448 A => A
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0024001053012 GS10 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0007001118232 Dingo T GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0061001325701 TM2 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0027001014907 GS3 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0012001303433 DQ4 T GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0056001650600 LUPWRUS00001 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0058001637051 LUPWRUS00003 T GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0026001001897 GS2 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0019001006816 FAMBGSD00001 T GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0052001274237 LJ7 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0075001339977 YJ6 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0070001383204 YJ1 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0072001343651 YJ3 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0066001336296 TM7 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0009001308412 DQ1 T GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0042001356915 KM7 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0037001102317 KM2 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0033001016395 GS9 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0030001026945 GS6 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0017001318725 DQ9 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0069001349835 YJ10 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0078001336551 YJ9 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0059001306631 TM10 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0040001165243 KM5 T GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0076001349127 YJ7 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0011001329321 DQ3 T GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0064001317194 TM5 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0005001580072 CHW Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0063001287882 TM4 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0060001300289 TM1 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0062001318135 TM3 T GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0068001258207 TM9 T GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0054001168676 LJ9 T GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0028000963851 GS4 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0038001003674 KM3 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0013001252597 DQ5 T GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0032001009826 GS8 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0073001293013 YJ4 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0031001014588 GS7 T GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0016001304075 DQ8 T GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0014001293070 DQ6 T GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
snp_cf0067001279621 TM8 Y GCGTCTCAGGGGCGGCCTGGAGCCCGCGGC GGCCGGGGCTGTGAGTGCCCGTCGCCGCTG 2014-07-19 2014-07-19
6.Fasta Information
AACCTGTCCA CCTCCCTGCG GCGTCTCAGG GGCGGCCTGG AGCCCGCGGC
T
GGCCGGGGCT GTGAGTGCCC GTCGCCGCTG CTCGCGGCTC AGCGGCTCGT