e.g. 1:1246..9423
SNP Detail For snp_cf0010001288984    [See in GBrowse]
1.General Information
SNP ID: snp_cf0010001288984
Organism: Canis familiaris
Individual: DQ2
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs22672636  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: CGACATCCTGCGCCCACTGCTGGCGTTTCC
3'flank: GAGGACCCCACGTCTGCGCAGGCGGCCAGG
3.Reference Map information
Chrom Position Reference DQ2
Chr18 200640 C G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003334 44775 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000005349 9210 CCC => CCG ENSCAFP00000004953 3070 P => P
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0007001118253 Dingo S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0061001325726 TM2 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0064001317220 TM5 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0014001293098 DQ6 G CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0057001567502 LUPWRUS00002 G CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0020001295771 FAMBTIM00001 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0040001165270 KM5 G CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0058001637073 LUPWRUS00003 G CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0068001258235 TM9 G CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0038001003699 KM3 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0033001016422 GS9 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0028000963879 GS4 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0019001006839 FAMBGSD00001 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0024001053039 GS10 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0066001336324 TM7 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0013001252627 DQ5 G CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0025001007671 GS1 G CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0060001300318 TM1 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0016001304103 DQ8 G CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0011001329349 DQ3 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0075001340005 YJ6 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0031001014615 GS7 G CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0012001303462 DQ4 G CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0003000735652 dbSNP139 G CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0073001293041 YJ4 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0055001635623 LUPWCHN00001 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0078001336579 YJ9 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0076001349148 YJ7 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0026001001924 GS2 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0059001306657 TM10 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0056001650633 LUPWRUS00001 G CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0041001311290 KM6 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0032001009850 GS8 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0052001274264 LJ7 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0027001014934 GS3 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0029000944101 GS5 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0070001383233 YJ1 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0030001026973 GS6 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0062001318165 TM3 G CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0037001102344 KM2 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0063001287908 TM4 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0009001308442 DQ1 G CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0001000557751 solidGW1 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-08-01 2014-08-01
snp_cf0067001279646 TM8 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0042001356940 KM7 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0005001580108 CHW G CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
snp_cf0017001318754 DQ9 S CGACATCCTGCGCCCACTGCTGGCGTTTCC GAGGACCCCACGTCTGCGCAGGCGGCCAGG 2014-07-19 2014-07-19
6.Fasta Information
CTGTCTGGGA GGTGCGACGC CGACATCCTG CGCCCACTGC TGGCGTTTCC
G
GAGGACCCCA CGTCTGCGCA GGCGGCCAGG GAGCTGTGTG GCCTGCCCGG