e.g. 1:1246..9423
SNP Detail For snp_cf0011000372736    [See in GBrowse]
1.General Information
SNP ID: snp_cf0011000372736
Organism: Canis familiaris
Individual: DQ3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: K
5'flank: TCCTCCTTCATCAATGCACTGCGGGAAATT
3'flank: GGCATGATGAGAAGGACTCAGCTCCCACTG
3.Reference Map information
Chrom Position Reference DQ3
Chr11 793685 G K
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000028671 322 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000036967 322 GGG => TGG ENSCAFP00000032403 108 G => W
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0029000237537 GS5 T TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0048000345272 LJ3 K TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0050000330568 LJ5 K TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0076000379816 YJ7 K TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0007000302109 Dingo T TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0035000349062 KM10 K TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0040000310008 KM5 T TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0077000375147 YJ8 K TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0039000287949 KM4 K TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0033000302352 GS9 K TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0037000314271 KM2 K TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0043000315060 KM8 K TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0070000389955 YJ1 K TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0017000381216 DQ9 K TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0045000309007 LJ10 K TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0016000371251 DQ8 K TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0036000298479 KM1 T TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0053000362417 LJ8 K TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0047000342509 LJ2 K TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0001000194141 solidGW1 T TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-08-01 2014-08-01
snp_cf0056000475407 LUPWRUS00001 T TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0038000293849 KM3 K TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0069000380821 YJ10 T TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0027000284563 GS3 K TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0018000304720 FAMBBEM00001 K TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0006000426923 CRW K TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0034000448484 ISW K TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0074000375495 YJ5 K TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0057000457647 LUPWRUS00002 K TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0078000380908 YJ9 T TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0073000381686 YJ4 K TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
snp_cf0055000469746 LUPWCHN00001 T TCCTCCTTCATCAATGCACTGCGGGAAATT GGCATGATGAGAAGGACTCAGCTCCCACTG 2014-07-19 2014-07-19
6.Fasta Information
GGGATTCTGG CAATGGCATG TCCTCCTTCA TCAATGCACT GCGGGAAATT
K
GGCATGATGA GAAGGACTCA GCTCCCACTG GGGTGGTAAG GACCACCCAG