e.g. 1:1246..9423
SNP Detail For snp_cf0011000372746    [See in GBrowse]
1.General Information
SNP ID: snp_cf0011000372746
Organism: Canis familiaris
Individual: DQ3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: GAAGAGGAGGGTTCTGCAAGTGTTGGAGTC
3'flank: TGGAGACTACCATGAAGAAAACGCCCTATC
3.Reference Map information
Chrom Position Reference DQ3
Chr11 838720 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000502 319 + G CDS
ENSCAFG00000000498 23111 - G intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000036952 319 GTG => ATG ENSCAFP00000032387 107 V => M
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
NA NA NA NA NA NA NA
6.Fasta Information
CCCTGCGAGG ACTTAGTTAT GAAGAGGAGG GTTCTGCAAG TGTTGGAGTC
R
TGGAGACTAC CATGAAGAAA ACGCCCTATC AACATCCAAA ATATCCCAAA