e.g. 1:1246..9423
SNP Detail For snp_cf0011000668660    [See in GBrowse]
1.General Information
SNP ID: snp_cf0011000668660
Organism: Canis familiaris
Individual: DQ3
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs22260427  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: TTGCTAATGAAGCACTTTTTATTTGCAGCC
3'flank: CCTAATTTTCCCTACAGAGATGATATCATG
3.Reference Map information
Chrom Position Reference DQ3
Chr13 92430 A T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000460 51482 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000000736 747 CCA => CCT ENSCAFP00000000679 249 P => P
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0023000620986 FAMICHN00003 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0004000554142 Basenji T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0043000536986 KM8 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0015000664539 DQ7 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0029000460501 GS5 W TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0021000631617 FAMICHN00001 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0073000670545 YJ4 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0075000683920 YJ6 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0048000630632 LJ3 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0020000651246 FAMBTIM00001 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0009000663850 DQ1 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0051000663635 LJ6 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0066000676704 TM7 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0034000782775 ISW T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0058000833969 LUPWRUS00003 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0012000661944 DQ4 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0018000552079 FAMBBEM00001 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0046000599951 LJ1 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0070000697198 YJ1 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0010000663051 DQ2 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0031000525889 GS7 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0055000832030 LUPWCHN00001 W TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0035000633028 KM10 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0016000662241 DQ8 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0017000674778 DQ9 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0076000680093 YJ7 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0057000816376 LUPWRUS00002 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0042000663901 KM7 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0033000521622 GS9 W TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0032000501867 GS8 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0027000515350 GS3 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0049000663554 LJ4 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0068000629121 TM9 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0064000671377 TM5 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0019000514226 FAMBGSD00001 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0061000675138 TM2 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0072000682973 YJ3 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0077000675709 YJ8 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0028000491976 GS4 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0039000509134 KM4 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0062000664054 TM3 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0074000671462 YJ5 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0052000641965 LJ7 W TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0065000643995 TM6 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0008000657694 DQ10 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0060000674598 TM1 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0037000531085 KM2 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0013000632777 DQ5 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0056000840698 LUPWRUS00001 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0078000676687 YJ9 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0005000813330 CHW T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0038000542231 KM3 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0044000584213 KM9 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0071000674930 YJ2 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0025000488614 GS1 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0047000631269 LJ2 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0007000554772 Dingo T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0041000641073 KM6 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0022000588181 FAMICHN00002 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0054000590147 LJ9 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0030000527091 GS6 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0053000645151 LJ8 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0063000653947 TM4 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0003000356802 dbSNP139 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0006000768225 CRW T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0059000671851 TM10 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0014000647349 DQ6 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0036000515756 KM1 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0040000580295 KM5 W TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0067000641123 TM8 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0024000538572 GS10 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0050000605622 LJ5 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0045000591977 LJ10 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0026000495872 GS2 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
snp_cf0069000684390 YJ10 T TTGCTAATGAAGCACTTTTTATTTGCAGCC CCTAATTTTCCCTACAGAGATGATATCATG 2014-07-19 2014-07-19
6.Fasta Information
TCTGGAATGA ATAATAAGCC TTGCTAATGA AGCACTTTTT ATTTGCAGCC
T
CCTAATTTTC CCTACAGAGA TGATATCATG TCGGTGAATC CTACCTGTTT