e.g. 1:1246..9423
SNP Detail For snp_cf0011000668866    [See in GBrowse]
1.General Information
SNP ID: snp_cf0011000668866
Organism: Canis familiaris
Individual: DQ3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: AATTGGACTCCTGTGCTGTGGGAGACCATG
3'flank: CTGTGAACATTCATGTGTAAGCAGTGGAGA
3.Reference Map information
Chrom Position Reference DQ3
Chr13 278440 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000013852 129124 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000000737 1607 GGC => GAC ENSCAFP00000000680 536 G => D
+ ENSCAFT00000021976 1607 GGC => GAC ENSCAFP00000020407 536 G => D
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0061000675334 TM2 A AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0023000621179 FAMICHN00003 A AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0075000684117 YJ6 R AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0062000664254 TM3 R AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0012000662141 DQ4 R AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0073000670742 YJ4 R AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0058000834160 LUPWRUS00003 A AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0014000647552 DQ6 R AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0006000768412 CRW A AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0021000631819 FAMICHN00001 R AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0067000641319 TM8 R AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0046000600144 LJ1 R AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0005000813533 CHW R AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0016000662425 DQ8 A AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0071000675120 YJ2 A AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0063000654150 TM4 R AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0054000590316 LJ9 R AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0002000431704 CID1 A AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-08-02 2014-08-02
snp_cf0007000554958 Dingo A AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0049000663760 LJ4 R AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0020000651448 FAMBTIM00001 R AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0057000816559 LUPWRUS00002 R AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0008000657889 DQ10 R AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0015000664747 DQ7 R AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0077000675910 YJ8 R AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0059000672053 TM10 R AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0068000629326 TM9 R AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0034000782960 ISW R AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0056000840905 LUPWRUS00001 A AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0066000676897 TM7 A AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0004000554325 Basenji A AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
snp_cf0018000552285 FAMBBEM00001 R AATTGGACTCCTGTGCTGTGGGAGACCATG CTGTGAACATTCATGTGTAAGCAGTGGAGA 2014-07-19 2014-07-19
6.Fasta Information
AATTCCAATT GGATTCCCAG AATTGGACTC CTGTGCTGTG GGAGACCATG
R
CTGTGAACAT TCATGTGTAA GCAGTGGAGA CTCTTTTGTG TGCCAGTGCT