e.g. 1:1246..9423
SNP Detail For snp_cf0011000668867    [See in GBrowse]
1.General Information
SNP ID: snp_cf0011000668867
Organism: Canis familiaris
Individual: DQ3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: AGTGGAGACTCTTTTGTGTGCCAGTGCTTT
3'flank: AAGGGTATATACTCCGTGAAGATGGGAAAA
3.Reference Map information
Chrom Position Reference DQ3
Chr13 278493 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000013852 129177 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000000737 1660 GAA => AAA ENSCAFP00000000680 554 E => K
+ ENSCAFT00000021976 1660 GAA => AAA ENSCAFP00000020407 554 E => K
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0023000621180 FAMICHN00003 A AGTGGAGACTCTTTTGTGTGCCAGTGCTTT AAGGGTATATACTCCGTGAAGATGGGAAAA 2014-07-19 2014-07-19
snp_cf0077000675911 YJ8 R AGTGGAGACTCTTTTGTGTGCCAGTGCTTT AAGGGTATATACTCCGTGAAGATGGGAAAA 2014-07-19 2014-07-19
snp_cf0071000675121 YJ2 A AGTGGAGACTCTTTTGTGTGCCAGTGCTTT AAGGGTATATACTCCGTGAAGATGGGAAAA 2014-07-19 2014-07-19
snp_cf0021000631820 FAMICHN00001 R AGTGGAGACTCTTTTGTGTGCCAGTGCTTT AAGGGTATATACTCCGTGAAGATGGGAAAA 2014-07-19 2014-07-19
snp_cf0054000590317 LJ9 R AGTGGAGACTCTTTTGTGTGCCAGTGCTTT AAGGGTATATACTCCGTGAAGATGGGAAAA 2014-07-19 2014-07-19
snp_cf0002000431705 CID1 A AGTGGAGACTCTTTTGTGTGCCAGTGCTTT AAGGGTATATACTCCGTGAAGATGGGAAAA 2014-08-02 2014-08-02
snp_cf0007000554959 Dingo A AGTGGAGACTCTTTTGTGTGCCAGTGCTTT AAGGGTATATACTCCGTGAAGATGGGAAAA 2014-07-19 2014-07-19
snp_cf0049000663761 LJ4 R AGTGGAGACTCTTTTGTGTGCCAGTGCTTT AAGGGTATATACTCCGTGAAGATGGGAAAA 2014-07-19 2014-07-19
6.Fasta Information
GTGAACATTC ATGTGTAAGC AGTGGAGACT CTTTTGTGTG CCAGTGCTTT
R
AAGGGTATAT ACTCCGTGAA GATGGGAAAA CCTGCAGAAG TAAGTTTTTA