e.g. 1:1246..9423
SNP Detail For snp_cf0011000668984    [See in GBrowse]
1.General Information
SNP ID: snp_cf0011000668984
Organism: Canis familiaris
Individual: DQ3
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs22299887  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: GTTGTAGAGTTTTGTAGCTTGATTCAGGAA
3'flank: CTAGAGCAGAAGACACTTACTGGGGCTTGG
3.Reference Map information
Chrom Position Reference DQ3
Chr13 435497 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000480 56218 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000039314 660 AAA => AAG ENSCAFP00000035150 220 K => K
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0075000684256 YJ6 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0047000631557 LJ2 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0008000658007 DQ10 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0060000674891 TM1 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0021000631933 FAMICHN00001 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0037000531378 KM2 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0077000676019 YJ8 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0006000768509 CRW C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0058000834264 LUPWRUS00003 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0046000600239 LJ1 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0032000502102 GS8 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0065000644270 TM6 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0018000552392 FAMBBEM00001 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0073000670866 YJ4 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0027000515686 GS3 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0016000662521 DQ8 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0003000357034 dbSNP139 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0045000592278 LJ10 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0038000542492 KM3 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0036000516018 KM1 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0009000664184 DQ1 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0022000588441 FAMICHN00002 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0034000783065 ISW C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0030000527398 GS6 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0061000675446 TM2 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0054000590403 LJ9 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0025000488876 GS1 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0015000664889 DQ7 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0056000841022 LUPWRUS00001 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0048000630924 LJ3 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0062000664365 TM3 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0059000672176 TM10 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0023000621290 FAMICHN00003 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0067000641428 TM8 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0033000521983 GS9 Y GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0010000663325 DQ2 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0004000554408 Basenji C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0005000813663 CHW C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0074000671737 YJ5 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0042000664232 KM7 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0028000492309 GS4 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0070000697483 YJ1 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0063000654266 TM4 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0076000680366 YJ7 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0029000460843 GS5 Y GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0007000555054 Dingo C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0012000662256 DQ4 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0035000633367 KM10 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0041000641417 KM6 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0078000677015 YJ9 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0071000675225 YJ2 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0053000645418 LJ8 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0014000647692 DQ6 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0040000580640 KM5 Y GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0017000675080 DQ9 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0049000663883 LJ4 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0055000832454 LUPWCHN00001 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0039000509469 KM4 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0057000816676 LUPWRUS00002 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0072000683239 YJ3 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0069000684662 YJ10 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0051000663905 LJ6 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0019000514551 FAMBGSD00001 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0013000633102 DQ5 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0052000642303 LJ7 Y GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0024000538848 GS10 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0002000431777 CID1 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-08-02 2014-08-02
snp_cf0068000629468 TM9 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0050000605909 LJ5 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0043000537295 KM8 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0044000584524 KM9 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0064000671649 TM5 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0066000677008 TM7 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0026000496201 GS2 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0020000651556 FAMBTIM00001 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
snp_cf0031000526163 GS7 C GTTGTAGAGTTTTGTAGCTTGATTCAGGAA CTAGAGCAGAAGACACTTACTGGGGCTTGG 2014-07-19 2014-07-19
6.Fasta Information
ACTGGCACCA CCATTGTTGT GTTGTAGAGT TTTGTAGCTT GATTCAGGAA
C
CTAGAGCAGA AGACACTTAC TGGGGCTTGG ACTTTAAGAG ACGCTCAGCA