e.g. 1:1246..9423
SNP Detail For snp_cf0011000669218    [See in GBrowse]
1.General Information
SNP ID: snp_cf0011000669218
Organism: Canis familiaris
Individual: DQ3
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs22262829  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: ATCAGTGAAATCATCAGACCAAAGTTCTGG
3'flank: TTCCTGAATGTTGGTGGTGGGTTTGTGGGA
3.Reference Map information
Chrom Position Reference DQ3
Chr13 770647 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000484 150263 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000000770 729 AAA => AAG ENSCAFP00000000711 243 K => K
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0052000642510 LJ7 Y ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0013000633372 DQ5 Y ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0029000461116 GS5 Y ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0062000664597 TM3 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0008000658246 DQ10 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0053000645632 LJ8 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0015000665157 DQ7 Y ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0070000697704 YJ1 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0045000592477 LJ10 Y ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0051000664120 LJ6 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0031000526432 GS7 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0050000606105 LJ5 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0072000683452 YJ3 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0060000675112 TM1 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0040000580914 KM5 Y ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0064000671866 TM5 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0076000680577 YJ7 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0061000675643 TM2 Y ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0023000621521 FAMICHN00003 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0058000834477 LUPWRUS00003 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0014000647958 DQ6 Y ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0028000492557 GS4 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0073000671129 YJ4 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0075000684568 YJ6 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0033000522283 GS9 Y ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0001000301068 solidGW1 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-08-01 2014-08-01
snp_cf0048000631144 LJ3 Y ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0006000768686 CRW Y ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0016000662710 DQ8 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0003000357289 dbSNP139 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0009000664454 DQ1 Y ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0074000671939 YJ5 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0041000641682 KM6 Y ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0004000554606 Basenji C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0067000641662 TM8 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0021000632160 FAMICHN00001 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0054000590646 LJ9 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0049000664126 LJ4 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0007000555254 Dingo C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0063000654500 TM4 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0069000684875 YJ10 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0043000537613 KM8 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0065000644486 TM6 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0056000841233 LUPWRUS00001 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0019000514861 FAMBGSD00001 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0057000816960 LUPWRUS00002 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0012000662495 DQ4 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0022000588649 FAMICHN00002 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0068000629777 TM9 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0071000675422 YJ2 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0020000651787 FAMBTIM00001 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0039000509742 KM4 Y ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0055000832693 LUPWCHN00001 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0038000542677 KM3 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0018000552578 FAMBBEM00001 Y ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0047000631829 LJ2 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0042000664525 KM7 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0059000672397 TM10 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0035000633688 KM10 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0046000600469 LJ1 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0077000676268 YJ8 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0032000502266 GS8 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0044000584845 KM9 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0017000675334 DQ9 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0027000515933 GS3 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0024000539027 GS10 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0037000531672 KM2 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0078000677247 YJ9 Y ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0025000489037 GS1 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0030000527648 GS6 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0005000813882 CHW C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0066000677205 TM7 Y ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0026000496520 GS2 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0010000663541 DQ2 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
snp_cf0036000516203 KM1 C ATCAGTGAAATCATCAGACCAAAGTTCTGG TTCCTGAATGTTGGTGGTGGGTTTGTGGGA 2014-07-19 2014-07-19
6.Fasta Information
ACTAGGCACT TTTTAACAAA ATCAGTGAAA TCATCAGACC AAAGTTCTGG
C
TTCCTGAATG TTGGTGGTGG GTTTGTGGGA ATCATAAAAA TAGCCTAGCA