e.g. 1:1246..9423
SNP Detail For snp_cf0011000669380    [See in GBrowse]
1.General Information
SNP ID: snp_cf0011000669380
Organism: Canis familiaris
Individual: DQ3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: K
5'flank: CACCCGTCGCTGCAGCTCACCAATTACTCC
3'flank: TCCTTCAGGCCGTGAACACCTTCCCAGCCG
3.Reference Map information
Chrom Position Reference DQ3
Chr13 1028581 T K
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000493 179 + T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000000778 67 TTC => GTC ENSCAFP00000000717 23 F => V
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
NA NA NA NA NA NA NA
6.Fasta Information
TGCCGGCGCC CATCCCGCTC CACCCGTCGC TGCAGCTCAC CAATTACTCC
K
TCCTTCAGGC CGTGAACACC TTCCCAGCCG CGGTGGACCA CCTGCAGGGC