e.g. 1:1246..9423
SNP Detail For snp_cf0011000927728    [See in GBrowse]
1.General Information
SNP ID: snp_cf0011000927728
Organism: Canis familiaris
Individual: DQ3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: CTCCGTGCCCTAGGTCTTCTATTACTCCAC
3'flank: AGCATCTTCGAGAAGGCGGGGGTGCAGCAG
3.Reference Map information
Chrom Position Reference DQ3
Chr15 489871 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000002500 25955 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000023821 885 ACA => ACG ENSCAFP00000022113 295 T => T
+ ENSCAFT00000003950 921 ACA => ACG ENSCAFP00000003651 307 T => T
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0063000903256 TM4 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0057001112921 LUPWRUS00002 G CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0072000941648 YJ3 G CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0018000764885 FAMBBEM00001 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0071000940065 YJ2 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0062000922759 TM3 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0009000923959 DQ1 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0056001167681 LUPWRUS00001 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0065000900404 TM6 G CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0061000932469 TM2 G CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0068000881394 TM9 G CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0004000758480 Basenji G CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0016000917081 DQ8 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0069000950654 YJ10 G CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0021000879174 FAMICHN00001 G CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0015000920170 DQ7 G CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0001000388410 solidGW1 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-08-01 2014-08-01
snp_cf0077000937481 YJ8 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0043000762360 KM8 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0034001081766 ISW G CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0020000911562 FAMBTIM00001 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0014000907524 DQ6 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0066000937915 TM7 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0035000894631 KM10 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0076000945630 YJ7 G CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0070000967715 YJ1 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0012000922927 DQ4 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0042000933577 KM7 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0005001130656 CHW G CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0059000929703 TM10 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0007000776047 Dingo R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0055001152785 LUPWCHN00001 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0017000935294 DQ9 G CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0060000924779 TM1 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0052000897024 LJ7 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0041000901865 KM6 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0008000906176 DQ10 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0058001147342 LUPWRUS00003 G CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
snp_cf0051000921000 LJ6 R CTCCGTGCCCTAGGTCTTCTATTACTCCAC AGCATCTTCGAGAAGGCGGGGGTGCAGCAG 2014-07-19 2014-07-19
6.Fasta Information
TGGCCGAGCC CCAACAGCCT CTCCGTGCCC TAGGTCTTCT ATTACTCCAC
G
AGCATCTTCG AGAAGGCGGG GGTGCAGCAG CCCGTGTATG CCACCATCGG