e.g. 1:1246..9423
SNP Detail For snp_cf0011000928059    [See in GBrowse]
1.General Information
SNP ID: snp_cf0011000928059
Organism: Canis familiaris
Individual: DQ3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: CCCGCAGTGGAAGCAGTCCTCCTACGCGGG
3'flank: GACGCCATCATCACGGCCGTGGGGCTCTAC
3.Reference Map information
Chrom Position Reference DQ3
Chr15 627270 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000002540 858 + T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000004009 111 GGT => GGC ENSCAFP00000003703 37 G => G
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0070000968060 YJ1 Y CCCGCAGTGGAAGCAGTCCTCCTACGCGGG GACGCCATCATCACGGCCGTGGGGCTCTAC 2014-07-19 2014-07-19
snp_cf0056001167934 LUPWRUS00001 Y CCCGCAGTGGAAGCAGTCCTCCTACGCGGG GACGCCATCATCACGGCCGTGGGGCTCTAC 2014-07-19 2014-07-19
snp_cf0071000940395 YJ2 Y CCCGCAGTGGAAGCAGTCCTCCTACGCGGG GACGCCATCATCACGGCCGTGGGGCTCTAC 2014-07-19 2014-07-19
snp_cf0072000941983 YJ3 C CCCGCAGTGGAAGCAGTCCTCCTACGCGGG GACGCCATCATCACGGCCGTGGGGCTCTAC 2014-07-19 2014-07-19
snp_cf0077000937830 YJ8 Y CCCGCAGTGGAAGCAGTCCTCCTACGCGGG GACGCCATCATCACGGCCGTGGGGCTCTAC 2014-07-19 2014-07-19
snp_cf0076000945982 YJ7 C CCCGCAGTGGAAGCAGTCCTCCTACGCGGG GACGCCATCATCACGGCCGTGGGGCTCTAC 2014-07-19 2014-07-19
snp_cf0017000935646 DQ9 Y CCCGCAGTGGAAGCAGTCCTCCTACGCGGG GACGCCATCATCACGGCCGTGGGGCTCTAC 2014-07-19 2014-07-19
snp_cf0074000935539 YJ5 Y CCCGCAGTGGAAGCAGTCCTCCTACGCGGG GACGCCATCATCACGGCCGTGGGGCTCTAC 2014-07-19 2014-07-19
snp_cf0057001113252 LUPWRUS00002 C CCCGCAGTGGAAGCAGTCCTCCTACGCGGG GACGCCATCATCACGGCCGTGGGGCTCTAC 2014-07-19 2014-07-19
snp_cf0021000879522 FAMICHN00001 Y CCCGCAGTGGAAGCAGTCCTCCTACGCGGG GACGCCATCATCACGGCCGTGGGGCTCTAC 2014-07-19 2014-07-19
snp_cf0061000932825 TM2 Y CCCGCAGTGGAAGCAGTCCTCCTACGCGGG GACGCCATCATCACGGCCGTGGGGCTCTAC 2014-07-19 2014-07-19
snp_cf0007000776343 Dingo C CCCGCAGTGGAAGCAGTCCTCCTACGCGGG GACGCCATCATCACGGCCGTGGGGCTCTAC 2014-07-19 2014-07-19
snp_cf0043000762682 KM8 Y CCCGCAGTGGAAGCAGTCCTCCTACGCGGG GACGCCATCATCACGGCCGTGGGGCTCTAC 2014-07-19 2014-07-19
snp_cf0064000928565 TM5 Y CCCGCAGTGGAAGCAGTCCTCCTACGCGGG GACGCCATCATCACGGCCGTGGGGCTCTAC 2014-07-19 2014-07-19
snp_cf0069000950999 YJ10 C CCCGCAGTGGAAGCAGTCCTCCTACGCGGG GACGCCATCATCACGGCCGTGGGGCTCTAC 2014-07-19 2014-07-19
6.Fasta Information
ATCATCGCCA GCACAGCCCT CCCGCAGTGG AAGCAGTCCT CCTACGCGGG
Y
GACGCCATCA TCACGGCCGT GGGGCTCTAC GAGGGGCTCT GGATGTCCTG