e.g. 1:1246..9423
SNP Detail For snp_cf0011001329216    [See in GBrowse]
1.General Information
SNP ID: snp_cf0011001329216
Organism: Canis familiaris
Individual: DQ3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: CTGGTTCTTCACTCACACACTTGGTCCCAG
3'flank: TTCAGCCCCTCTCACCTCAGAGCGTCTGTC
3.Reference Map information
Chrom Position Reference DQ3
Chr18 169350 A T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003334 13485 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000005349 1072 ATT => TTT ENSCAFP00000004953 358 I => F
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0078001336448 YJ9 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0027001014807 GS3 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0040001165139 KM5 T CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0058001636964 LUPWRUS00003 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0075001339874 YJ6 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0073001292915 YJ4 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0047001265515 LJ2 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0019001006719 FAMBGSD00001 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0026001001795 GS2 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0052001274134 LJ7 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0041001311211 KM6 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0055001635506 LUPWCHN00001 T CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0017001318621 DQ9 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0007001118143 Dingo T CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0076001349028 YJ7 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0056001650475 LUPWRUS00001 T CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0010001288851 DQ2 T CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0005001579956 CHW T CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0068001258106 TM9 T CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0020001295645 FAMBTIM00001 T CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0031001014486 GS7 T CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0024001052913 GS10 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0038001003574 KM3 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0009001308306 DQ1 T CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0006001514628 CRW T CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0057001567382 LUPWRUS00002 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0001000557634 solidGW1 T CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-08-01 2014-08-01
snp_cf0062001318028 TM3 T CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0025001007547 GS1 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0014001292965 DQ6 T CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0072001343552 YJ3 T CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0070001383101 YJ1 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0016001303974 DQ8 T CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0066001336195 TM7 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0037001102217 KM2 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0067001279519 TM8 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0030001026840 GS6 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0059001306531 TM10 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0012001303328 DQ4 T CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0060001300184 TM1 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0029000943976 GS5 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0061001325599 TM2 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0064001317095 TM5 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0069001349731 YJ10 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0063001287785 TM4 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0028000963747 GS4 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0051001306463 LJ6 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0042001356826 KM7 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0032001009729 GS8 W CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
snp_cf0013001252494 DQ5 T CTGGTTCTTCACTCACACACTTGGTCCCAG TTCAGCCCCTCTCACCTCAGAGCGTCTGTC 2014-07-19 2014-07-19
6.Fasta Information
TCCCAGGGTG CGACCCCCAC CTGGTTCTTC ACTCACACAC TTGGTCCCAG
T
TTCAGCCCCT CTCACCTCAG AGCGTCTGTC TTTGGAGCTG CTCTCCTGGG