e.g. 1:1246..9423
SNP Detail For snp_cf0011001329222    [See in GBrowse]
1.General Information
SNP ID: snp_cf0011001329222
Organism: Canis familiaris
Individual: DQ3
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs22664230  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC
3'flank: ACGAGACCAGCGTCCTGAACAAGCTCCTGA
3.Reference Map information
Chrom Position Reference DQ3
Chr18 170509 G A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003334 14644 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000005349 1477 GAC => AAC ENSCAFP00000004953 493 D => N
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0064001317100 TM5 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0061001325605 TM2 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0056001650484 LUPWRUS00001 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0012001303334 DQ4 A GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0070001383107 YJ1 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0052001274138 LJ7 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0033001016301 GS9 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0029000943981 GS5 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0066001336200 TM7 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0009001308312 DQ1 A GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0062001318034 TM3 A GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0031001014492 GS7 A GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0025001007552 GS1 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0030001026845 GS6 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0032001009734 GS8 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0072001343558 YJ3 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0075001339880 YJ6 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0017001318625 DQ9 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0041001311217 KM6 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0001000557641 solidGW1 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-08-01 2014-08-01
snp_cf0069001349737 YJ10 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0003000735612 dbSNP139 A GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0040001165145 KM5 A GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0010001288857 DQ2 A GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0059001306535 TM10 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0078001336454 YJ9 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0073001292921 YJ4 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0026001001801 GS2 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0014001292970 DQ6 A GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0019001006725 FAMBGSD00001 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0063001287788 TM4 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0007001118149 Dingo R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0027001014813 GS3 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0016001303980 DQ8 A GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0020001295649 FAMBTIM00001 A GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0037001102223 KM2 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0024001052919 GS10 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0005001579963 CHW R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0028000963752 GS4 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0068001258111 TM9 A GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0060001300190 TM1 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0013001252499 DQ5 A GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0076001349033 YJ7 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0067001279525 TM8 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
snp_cf0055001635512 LUPWCHN00001 R GCGGCCCTCCCGTGTCCCCGCGGCTTCTCC ACGAGACCAGCGTCCTGAACAAGCTCCTGA 2014-07-19 2014-07-19
6.Fasta Information
ACGCGAGCGT GTCCGGGAGG GCGGCCCTCC CGTGTCCCCG CGGCTTCTCC
A
ACGAGACCAG CGTCCTGAAC AAGCTCCTGA GGTCAGCAGA GGATGCGGTG