e.g. 1:1246..9423
SNP Detail For snp_cf0011001329243    [See in GBrowse]
1.General Information
SNP ID: snp_cf0011001329243
Organism: Canis familiaris
Individual: DQ3
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs8883670  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: AGTCAGAAACTCTTGGAATTTGGCAAAGCA
3'flank: TGATTGACAAAATAGAAACTCTTGAACATC
3.Reference Map information
Chrom Position Reference DQ3
Chr18 178227 G A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003334 22362 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000005349 2263 GTG => ATG ENSCAFP00000004953 755 V => M
+ ENSCAFT00000044856 697 GTG => ATG ENSCAFP00000038766 233 V => M
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0057001567407 LUPWRUS00002 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0005001579988 CHW A AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0070001383129 YJ1 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0037001102243 KM2 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0060001300211 TM1 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0032001009754 GS8 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0025001007572 GS1 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0051001306481 LJ6 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0016001304001 DQ8 A AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0072001343578 YJ3 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0030001026867 GS6 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0050001214355 LJ5 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0069001349757 YJ10 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0073001292941 YJ4 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0056001650511 LUPWRUS00001 A AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0059001306556 TM10 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0026001001821 GS2 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0034001539268 ISW R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0062001318057 TM3 A AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0075001339900 YJ6 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0029000944002 GS5 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0066001336220 TM7 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0002000858998 CID1 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-08-02 2014-08-02
snp_cf0063001287808 TM4 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0028000963774 GS4 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0042001356847 KM7 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0054001168639 LJ9 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0055001635535 LUPWCHN00001 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0067001279544 TM8 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0047001265531 LJ2 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0061001325626 TM2 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0064001317120 TM5 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0012001303355 DQ4 A AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0020001295672 FAMBTIM00001 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0038001003599 KM3 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0033001016322 GS9 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0009001308334 DQ1 A AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0019001006745 FAMBGSD00001 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0017001318646 DQ9 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0013001252520 DQ5 A AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0078001336474 YJ9 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0031001014513 GS7 A AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0003000735615 dbSNP139 A AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0040001165167 KM5 A AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0052001274161 LJ7 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0007001118167 Dingo A AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0010001288878 DQ2 A AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0058001636991 LUPWRUS00003 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0006001514651 CRW A AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0014001292991 DQ6 A AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0027001014833 GS3 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0068001258132 TM9 A AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0024001052939 GS10 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
snp_cf0076001349054 YJ7 R AGTCAGAAACTCTTGGAATTTGGCAAAGCA TGATTGACAAAATAGAAACTCTTGAACATC 2014-07-19 2014-07-19
6.Fasta Information
GAGACCCATC TGCTATTGAT AGTCAGAAAC TCTTGGAATT TGGCAAAGCA
A
TGATTGACAA AATAGAAACT CTTGAACATC TCTGGATAAA GAAGGAATCA