e.g. 1:1246..9423
SNP Detail For snp_cf0011001329244    [See in GBrowse]
1.General Information
SNP ID: snp_cf0011001329244
Organism: Canis familiaris
Individual: DQ3
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: AAAGTGATGTGAAAATTTCTGAAAGCTGCC
3'flank: GGGAATATTTCCCACCCATCACCCTGCCAG
3.Reference Map information
Chrom Position Reference DQ3
Chr18 179422 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003334 23557 + T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000005349 3458 CTG => CCG ENSCAFP00000004953 1153 L => P
+ ENSCAFT00000044856 1892 CTG => CCG ENSCAFP00000038766 631 L => P
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0001000557657 solidGW1 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-08-01 2014-08-01
snp_cf0034001539270 ISW Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0037001102244 KM2 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0060001300212 TM1 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0057001567408 LUPWRUS00002 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0016001304002 DQ8 C AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0032001009755 GS8 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0051001306482 LJ6 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0005001579990 CHW C AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0025001007573 GS1 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0050001214356 LJ5 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0030001026868 GS6 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0072001343579 YJ3 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0069001349758 YJ10 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0059001306557 TM10 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0073001292942 YJ4 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0026001001822 GS2 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0056001650513 LUPWRUS00001 C AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0038001003600 KM3 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0029000944003 GS5 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0062001318058 TM3 C AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0075001339901 YJ6 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0028000963775 GS4 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0066001336221 TM7 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0042001356848 KM7 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0063001287809 TM4 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0002000858999 CID1 C AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-08-02 2014-08-02
snp_cf0055001635536 LUPWCHN00001 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0067001279545 TM8 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0061001325627 TM2 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0064001317121 TM5 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0012001303356 DQ4 C AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0047001265532 LJ2 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0024001052940 GS10 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0020001295673 FAMBTIM00001 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0033001016323 GS9 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0009001308335 DQ1 C AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0054001168640 LJ9 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0019001006746 FAMBGSD00001 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0013001252521 DQ5 C AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0017001318647 DQ9 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0078001336475 YJ9 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0031001014514 GS7 C AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0040001165168 KM5 C AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0052001274162 LJ7 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0058001636992 LUPWRUS00003 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0010001288879 DQ2 C AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0006001514652 CRW C AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0014001292992 DQ6 C AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0007001118168 Dingo Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0027001014834 GS3 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0070001383130 YJ1 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0068001258133 TM9 C AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0041001311229 KM6 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
snp_cf0076001349055 YJ7 Y AAAGTGATGTGAAAATTTCTGAAAGCTGCC GGGAATATTTCCCACCCATCACCCTGCCAG 2014-07-19 2014-07-19
6.Fasta Information
TCAGCTTCTG GATGAATTGG AAAGTGATGT GAAAATTTCT GAAAGCTGCC
C
GGGAATATTT CCCACCCATC ACCCTGCCAG ACTCATACTG GATTTGTTTA