e.g. 1:1246..9423
SNP Detail For snp_cf0013001467748    [See in GBrowse]
1.General Information
SNP ID: snp_cf0013001467748
Organism: Canis familiaris
Individual: DQ5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: W
5'flank: CAAAATGTTTCATCCAAATGTGTATGCTGA
3'flank: GGTAGCATATGTTTAGATATCCTTCAGAAT
3.Reference Map information
Chrom Position Reference DQ5
Chr2 382238 T W
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003666 258 + T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000005887 258 GAT => GAA ENSCAFP00000038532 86 D => E
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0010001527809 DQ2 W CAAAATGTTTCATCCAAATGTGTATGCTGA GGTAGCATATGTTTAGATATCCTTCAGAAT 2014-07-19 2014-07-19
6.Fasta Information
CCAACTGTTA GGTTGTCATC CAAAATGTTT CATCCAAATG TGTATGCTGA
W
GGTAGCATAT GTTTAGATAT CCTTCAGAAT CCATGGAGTC CAACATATGA