e.g. 1:1246..9423
SNP Detail For snp_cf0013001467762    [See in GBrowse]
1.General Information
SNP ID: snp_cf0013001467762
Organism: Canis familiaris
Individual: DQ5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: AGTATAGCACAGCCCTTTTGTGAAGATGAT
3'flank: AGCAAATACATGAAATATTCCATATTAAAA
3.Reference Map information
Chrom Position Reference DQ5
Chr2 425047 A R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000028129 77 + A NON_CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0010001527818 DQ2 R AGTATAGCACAGCCCTTTTGTGAAGATGAT AGCAAATACATGAAATATTCCATATTAAAA 2014-07-19 2014-07-19
6.Fasta Information
ACAATTGAAT AATACAGAGA AGTATAGCAC AGCCCTTTTG TGAAGATGAT
R
AGCAAATACA TGAAATATTC CATATTAAAA AAAAGAAAAA AGGGCAGAGG