e.g. 1:1246..9423
SNP Detail For snp_cf0013001468515    [See in GBrowse]
1.General Information
SNP ID: snp_cf0013001468515
Organism: Canis familiaris
Individual: DQ5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: TCTGGATCCCGCCCTGCGTGTCTCGCCAGA
3'flank: GGGACCTGCCCACACCTCGCCCGACCGCCG
3.Reference Map information
Chrom Position Reference DQ5
Chr2 1318592 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000029576 1312 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000044664 1312 CTC => TTC ENSCAFP00000035908 438 L => F
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0032001189235 GS8 A TCTGGATCCCGCCCTGCGTGTCTCGCCAGA GGGACCTGCCCACACCTCGCCCGACCGCCG 2014-07-19 2014-07-19
snp_cf0036001208814 KM1 A TCTGGATCCCGCCCTGCGTGTCTCGCCAGA GGGACCTGCCCACACCTCGCCCGACCGCCG 2014-07-19 2014-07-19
snp_cf0031001205425 GS7 R TCTGGATCCCGCCCTGCGTGTCTCGCCAGA GGGACCTGCCCACACCTCGCCCGACCGCCG 2014-07-19 2014-07-19
snp_cf0028001145979 GS4 R TCTGGATCCCGCCCTGCGTGTCTCGCCAGA GGGACCTGCCCACACCTCGCCCGACCGCCG 2014-07-19 2014-07-19
snp_cf0010001528117 DQ2 R TCTGGATCCCGCCCTGCGTGTCTCGCCAGA GGGACCTGCCCACACCTCGCCCGACCGCCG 2014-07-19 2014-07-19
snp_cf0039001269495 KM4 A TCTGGATCCCGCCCTGCGTGTCTCGCCAGA GGGACCTGCCCACACCTCGCCCGACCGCCG 2014-07-19 2014-07-19
snp_cf0040001369944 KM5 A TCTGGATCCCGCCCTGCGTGTCTCGCCAGA GGGACCTGCCCACACCTCGCCCGACCGCCG 2014-07-19 2014-07-19
snp_cf0033001209286 GS9 R TCTGGATCCCGCCCTGCGTGTCTCGCCAGA GGGACCTGCCCACACCTCGCCCGACCGCCG 2014-07-19 2014-07-19
snp_cf0034001821639 ISW A TCTGGATCCCGCCCTGCGTGTCTCGCCAGA GGGACCTGCCCACACCTCGCCCGACCGCCG 2014-07-19 2014-07-19
snp_cf0025001186672 GS1 A TCTGGATCCCGCCCTGCGTGTCTCGCCAGA GGGACCTGCCCACACCTCGCCCGACCGCCG 2014-07-19 2014-07-19
6.Fasta Information
CCGGGCCGCG CCGCTCGGCG TCTGGATCCC GCCCTGCGTG TCTCGCCAGA
R
GGGACCTGCC CACACCTCGC CCGACCGCCG GCCCGCAGCG CGCAGCGGAC