e.g. 1:1246..9423
SNP Detail For snp_cf0013001468516    [See in GBrowse]
1.General Information
SNP ID: snp_cf0013001468516
Organism: Canis familiaris
Individual: DQ5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: S
5'flank: GGCCCCCCGTGCGGGCGCGTCCCGGGAGGG
3'flank: ACCAGGACCAGGTCGTCTGCGGACCCGCGT
3.Reference Map information
Chrom Position Reference DQ5
Chr2 1319114 C S
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000029576 790 - C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000044664 790 GCC => CCC ENSCAFP00000035908 264 A => P
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0036001208815 KM1 G GGCCCCCCGTGCGGGCGCGTCCCGGGAGGG ACCAGGACCAGGTCGTCTGCGGACCCGCGT 2014-07-19 2014-07-19
snp_cf0001000660374 solidGW1 G GGCCCCCCGTGCGGGCGCGTCCCGGGAGGG ACCAGGACCAGGTCGTCTGCGGACCCGCGT 2014-08-01 2014-08-01
snp_cf0011001567280 DQ3 S GGCCCCCCGTGCGGGCGCGTCCCGGGAGGG ACCAGGACCAGGTCGTCTGCGGACCCGCGT 2014-07-19 2014-07-19
snp_cf0039001269496 KM4 G GGCCCCCCGTGCGGGCGCGTCCCGGGAGGG ACCAGGACCAGGTCGTCTGCGGACCCGCGT 2014-07-19 2014-07-19
snp_cf0025001186673 GS1 G GGCCCCCCGTGCGGGCGCGTCCCGGGAGGG ACCAGGACCAGGTCGTCTGCGGACCCGCGT 2014-07-19 2014-07-19
snp_cf0014001514217 DQ6 G GGCCCCCCGTGCGGGCGCGTCCCGGGAGGG ACCAGGACCAGGTCGTCTGCGGACCCGCGT 2014-07-19 2014-07-19
snp_cf0077001566882 YJ8 S GGCCCCCCGTGCGGGCGCGTCCCGGGAGGG ACCAGGACCAGGTCGTCTGCGGACCCGCGT 2014-07-19 2014-07-19
snp_cf0058001935210 LUPWRUS00003 G GGCCCCCCGTGCGGGCGCGTCCCGGGAGGG ACCAGGACCAGGTCGTCTGCGGACCCGCGT 2014-07-19 2014-07-19
snp_cf0008001537207 DQ10 S GGCCCCCCGTGCGGGCGCGTCCCGGGAGGG ACCAGGACCAGGTCGTCTGCGGACCCGCGT 2014-07-19 2014-07-19
snp_cf0035001496836 KM10 G GGCCCCCCGTGCGGGCGCGTCCCGGGAGGG ACCAGGACCAGGTCGTCTGCGGACCCGCGT 2014-07-19 2014-07-19
snp_cf0060001526674 TM1 S GGCCCCCCGTGCGGGCGCGTCCCGGGAGGG ACCAGGACCAGGTCGTCTGCGGACCCGCGT 2014-07-19 2014-07-19
snp_cf0043001302156 KM8 G GGCCCCCCGTGCGGGCGCGTCCCGGGAGGG ACCAGGACCAGGTCGTCTGCGGACCCGCGT 2014-07-19 2014-07-19
snp_cf0034001821640 ISW G GGCCCCCCGTGCGGGCGCGTCCCGGGAGGG ACCAGGACCAGGTCGTCTGCGGACCCGCGT 2014-07-19 2014-07-19
snp_cf0067001518316 TM8 S GGCCCCCCGTGCGGGCGCGTCCCGGGAGGG ACCAGGACCAGGTCGTCTGCGGACCCGCGT 2014-07-19 2014-07-19
snp_cf0010001528118 DQ2 G GGCCCCCCGTGCGGGCGCGTCCCGGGAGGG ACCAGGACCAGGTCGTCTGCGGACCCGCGT 2014-07-19 2014-07-19
snp_cf0038001212347 KM3 G GGCCCCCCGTGCGGGCGCGTCCCGGGAGGG ACCAGGACCAGGTCGTCTGCGGACCCGCGT 2014-07-19 2014-07-19
snp_cf0032001189237 GS8 G GGCCCCCCGTGCGGGCGCGTCCCGGGAGGG ACCAGGACCAGGTCGTCTGCGGACCCGCGT 2014-07-19 2014-07-19
snp_cf0033001209287 GS9 G GGCCCCCCGTGCGGGCGCGTCCCGGGAGGG ACCAGGACCAGGTCGTCTGCGGACCCGCGT 2014-07-19 2014-07-19
6.Fasta Information
CCGCCGCCGC CCGGGCCTCG GGCCCCCCGT GCGGGCGCGT CCCGGGAGGG
S
ACCAGGACCA GGTCGTCTGC GGACCCGCGT TCTGGCCCGC GCGGGCCGCG