e.g. 1:1246..9423
SNP Detail For snp_cf0013001468517    [See in GBrowse]
1.General Information
SNP ID: snp_cf0013001468517
Organism: Canis familiaris
Individual: DQ5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: CTCCCCGCTCCTCCGGCTCGGTCGCCGAGT
3'flank: TCCCGGCGCCCCTCTGCACGCCGCGGGGCC
3.Reference Map information
Chrom Position Reference DQ5
Chr2 1319211 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000029576 693 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000044664 693 GAA => GAG ENSCAFP00000035908 231 E => E
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0065001525376 TM6 C CTCCCCGCTCCTCCGGCTCGGTCGCCGAGT TCCCGGCGCCCCTCTGCACGCCGCGGGGCC 2014-07-19 2014-07-19
snp_cf0011001567281 DQ3 Y CTCCCCGCTCCTCCGGCTCGGTCGCCGAGT TCCCGGCGCCCCTCTGCACGCCGCGGGGCC 2014-07-19 2014-07-19
snp_cf0012001541665 DQ4 Y CTCCCCGCTCCTCCGGCTCGGTCGCCGAGT TCCCGGCGCCCCTCTGCACGCCGCGGGGCC 2014-07-19 2014-07-19
snp_cf0068001498549 TM9 C CTCCCCGCTCCTCCGGCTCGGTCGCCGAGT TCCCGGCGCCCCTCTGCACGCCGCGGGGCC 2014-07-19 2014-07-19
snp_cf0064001561852 TM5 Y CTCCCCGCTCCTCCGGCTCGGTCGCCGAGT TCCCGGCGCCCCTCTGCACGCCGCGGGGCC 2014-07-19 2014-07-19
snp_cf0075001583109 YJ6 Y CTCCCCGCTCCTCCGGCTCGGTCGCCGAGT TCCCGGCGCCCCTCTGCACGCCGCGGGGCC 2014-07-19 2014-07-19
snp_cf0069001596881 YJ10 C CTCCCCGCTCCTCCGGCTCGGTCGCCGAGT TCCCGGCGCCCCTCTGCACGCCGCGGGGCC 2014-07-19 2014-07-19
snp_cf0021001468300 FAMICHN00001 C CTCCCCGCTCCTCCGGCTCGGTCGCCGAGT TCCCGGCGCCCCTCTGCACGCCGCGGGGCC 2014-07-19 2014-07-19
snp_cf0078001578236 YJ9 C CTCCCCGCTCCTCCGGCTCGGTCGCCGAGT TCCCGGCGCCCCTCTGCACGCCGCGGGGCC 2014-07-19 2014-07-19
snp_cf0020001534205 FAMBTIM00001 Y CTCCCCGCTCCTCCGGCTCGGTCGCCGAGT TCCCGGCGCCCCTCTGCACGCCGCGGGGCC 2014-07-19 2014-07-19
snp_cf0077001566883 YJ8 Y CTCCCCGCTCCTCCGGCTCGGTCGCCGAGT TCCCGGCGCCCCTCTGCACGCCGCGGGGCC 2014-07-19 2014-07-19
snp_cf0059001535721 TM10 C CTCCCCGCTCCTCCGGCTCGGTCGCCGAGT TCCCGGCGCCCCTCTGCACGCCGCGGGGCC 2014-07-19 2014-07-19
snp_cf0035001496837 KM10 Y CTCCCCGCTCCTCCGGCTCGGTCGCCGAGT TCCCGGCGCCCCTCTGCACGCCGCGGGGCC 2014-07-19 2014-07-19
snp_cf0008001537208 DQ10 Y CTCCCCGCTCCTCCGGCTCGGTCGCCGAGT TCCCGGCGCCCCTCTGCACGCCGCGGGGCC 2014-07-19 2014-07-19
snp_cf0060001526675 TM1 Y CTCCCCGCTCCTCCGGCTCGGTCGCCGAGT TCCCGGCGCCCCTCTGCACGCCGCGGGGCC 2014-07-19 2014-07-19
snp_cf0070001635031 YJ1 Y CTCCCCGCTCCTCCGGCTCGGTCGCCGAGT TCCCGGCGCCCCTCTGCACGCCGCGGGGCC 2014-07-19 2014-07-19
snp_cf0074001564793 YJ5 Y CTCCCCGCTCCTCCGGCTCGGTCGCCGAGT TCCCGGCGCCCCTCTGCACGCCGCGGGGCC 2014-07-19 2014-07-19
snp_cf0056001955260 LUPWRUS00001 Y CTCCCCGCTCCTCCGGCTCGGTCGCCGAGT TCCCGGCGCCCCTCTGCACGCCGCGGGGCC 2014-07-19 2014-07-19
snp_cf0009001543447 DQ1 C CTCCCCGCTCCTCCGGCTCGGTCGCCGAGT TCCCGGCGCCCCTCTGCACGCCGCGGGGCC 2014-07-19 2014-07-19
snp_cf0038001212348 KM3 Y CTCCCCGCTCCTCCGGCTCGGTCGCCGAGT TCCCGGCGCCCCTCTGCACGCCGCGGGGCC 2014-07-19 2014-07-19
snp_cf0042001610450 KM7 Y CTCCCCGCTCCTCCGGCTCGGTCGCCGAGT TCCCGGCGCCCCTCTGCACGCCGCGGGGCC 2014-07-19 2014-07-19
snp_cf0044001367533 KM9 Y CTCCCCGCTCCTCCGGCTCGGTCGCCGAGT TCCCGGCGCCCCTCTGCACGCCGCGGGGCC 2014-07-19 2014-07-19
6.Fasta Information
CGCGACCGGC AGGGCACTCG CTCCCCGCTC CTCCGGCTCG GTCGCCGAGT
Y
TCCCGGCGCC CCTCTGCACG CCGCGGGGCC GAGGGCGCGG GGCCGAGGCG