e.g. 1:1246..9423
SNP Detail For snp_cf0013001468600    [See in GBrowse]
1.General Information
SNP ID: snp_cf0013001468600
Organism: Canis familiaris
Individual: DQ5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: AAGTAAACCTAAAGTATATACCTATGTGTC
3'flank: AGTGATTCATACTGCAAAAGTAAAACTAAA
3.Reference Map information
Chrom Position Reference DQ5
Chr2 1387695 A R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003678 332312 - A NON_CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0061001570068 TM2 R AAGTAAACCTAAAGTATATACCTATGTGTC AGTGATTCATACTGCAAAAGTAAAACTAAA 2014-07-19 2014-07-19
snp_cf0064001561942 TM5 R AAGTAAACCTAAAGTATATACCTATGTGTC AGTGATTCATACTGCAAAAGTAAAACTAAA 2014-07-19 2014-07-19
snp_cf0007001328536 Dingo R AAGTAAACCTAAAGTATATACCTATGTGTC AGTGATTCATACTGCAAAAGTAAAACTAAA 2014-07-19 2014-07-19
snp_cf0051001538349 LJ6 R AAGTAAACCTAAAGTATATACCTATGTGTC AGTGATTCATACTGCAAAAGTAAAACTAAA 2014-07-19 2014-07-19
snp_cf0018001302211 FAMBBEM00001 R AAGTAAACCTAAAGTATATACCTATGTGTC AGTGATTCATACTGCAAAAGTAAAACTAAA 2014-07-19 2014-07-19
snp_cf0023001442743 FAMICHN00003 R AAGTAAACCTAAAGTATATACCTATGTGTC AGTGATTCATACTGCAAAAGTAAAACTAAA 2014-07-19 2014-07-19
snp_cf0044001367610 KM9 R AAGTAAACCTAAAGTATATACCTATGTGTC AGTGATTCATACTGCAAAAGTAAAACTAAA 2014-07-19 2014-07-19
6.Fasta Information
CATCATCATG TAGAAAAATA AAGTAAACCT AAAGTATATA CCTATGTGTC
R
AGTGATTCAT ACTGCAAAAG TAAAACTAAA ATCTACACTT ACAGCAAAAT