e.g. 1:1246..9423
SNP Detail For snp_cf0013001468601    [See in GBrowse]
1.General Information
SNP ID: snp_cf0013001468601
Organism: Canis familiaris
Individual: DQ5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: GCAGGCATGTTTGAGGCGTATGACTTTAGG
3'flank: GACCCAAGACTAATAAGATTTCAAAGTTTT
3.Reference Map information
Chrom Position Reference DQ5
Chr2 1388569 C G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003678 331438 - C NON_CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0053001506917 LJ8 S GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0041001556064 KM6 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0055001932221 LUPWCHN00001 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0012001541749 DQ4 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0048001470258 LJ3 S GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0031001205480 GS7 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0062001558362 TM3 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0045001397293 LJ10 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0007001328539 Dingo G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0009001543494 DQ1 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0061001570069 TM2 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0046001437633 LJ1 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0011001567399 DQ3 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0036001208864 KM1 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0044001367611 KM9 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0074001564877 YJ5 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0004001298183 Basenji G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0030001200184 GS6 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0052001510212 LJ7 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0019001184222 FAMBGSD00001 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0069001596998 YJ10 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0078001578370 YJ9 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0032001189288 GS8 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0020001534273 FAMBTIM00001 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0059001535793 TM10 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0035001496911 KM10 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0017001557191 DQ9 S GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0057001857702 LUPWRUS00002 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0021001468371 FAMICHN00001 S GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0033001209345 GS9 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0065001525438 TM6 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0056001955336 LUPWRUS00001 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0068001498628 TM9 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0025001186736 GS1 S GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0063001526516 TM4 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0015001544638 DQ7 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0038001212480 KM3 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0016001544967 DQ8 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0029001127570 GS5 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0037001292589 KM2 S GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0077001567004 YJ8 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0054001383254 LJ9 S GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0039001269629 KM4 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0014001514298 DQ6 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0047001499918 LJ2 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0023001442745 FAMICHN00003 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0070001635162 YJ1 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0067001518391 TM8 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0051001538350 LJ6 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0072001589284 YJ3 S GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0022001403488 FAMICHN00002 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0064001561943 TM5 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0066001576409 TM7 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0042001610591 KM7 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0008001537280 DQ10 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0006001795573 CRW G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0050001438872 LJ5 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0005001871058 CHW G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0071001579383 YJ2 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0018001302212 FAMBBEM00001 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0058001935260 LUPWRUS00003 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0010001528190 DQ2 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0024001235131 GS10 S GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0028001146028 GS4 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0040001370018 KM5 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0002001020103 CID1 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-08-02 2014-08-02
snp_cf0076001595694 YJ7 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0075001583193 YJ6 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0060001526744 TM1 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0049001555013 LJ4 G GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0026001181789 GS2 S GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
snp_cf0027001205121 GS3 S GCAGGCATGTTTGAGGCGTATGACTTTAGG GACCCAAGACTAATAAGATTTCAAAGTTTT 2014-07-19 2014-07-19
6.Fasta Information
CGAAGTACGT TTCATCAGAA GCAGGCATGT TTGAGGCGTA TGACTTTAGG
G
GACCCAAGAC TAATAAGATT TCAAAGTTTT CCACATTCAC ATAGCAGGAA