e.g. 1:1246..9423
SNP Detail For snp_cf0014000359668    [See in GBrowse]
1.General Information
SNP ID: snp_cf0014000359668
Organism: Canis familiaris
Individual: DQ6
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: CTCCTCCGGGATTTGAACCCGGGACCTCTC
3'flank: CACCCAAAGCGAGAATCATACCCCTAGACC
3.Reference Map information
Chrom Position Reference DQ6
Chr11 388909 C G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000012915 154287 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000020494 1339 CCA => GCA ENSCAFP00000019020 447 P => A
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0053000362316 LJ8 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0024000312633 GS10 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0009000370120 DQ1 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0010000370535 DQ2 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0019000287003 FAMBGSD00001 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0044000325052 KM9 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0057000457384 LUPWRUS00002 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0063000370395 TM4 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0056000475312 LUPWRUS00001 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0027000284475 GS3 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0070000389851 YJ1 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0047000342421 LJ2 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0049000375017 LJ4 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0069000380719 YJ10 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0067000362934 TM8 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0059000374012 TM10 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0051000364940 LJ6 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0066000376007 TM7 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0074000375421 YJ5 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0072000381568 YJ3 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0004000302293 Basenji G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0071000374506 YJ2 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0046000336023 LJ1 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0008000362536 DQ10 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0023000339892 FAMICHN00003 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0039000287855 KM4 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0026000286399 GS2 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0055000469671 LUPWCHN00001 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0031000293676 GS7 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0062000373717 TM3 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0025000271383 GS1 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0038000293762 KM3 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0006000426838 CRW G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0037000314181 KM2 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0011000372636 DQ3 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0054000328099 LJ9 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0058000470156 LUPWRUS00003 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0032000273850 GS8 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0035000348952 KM10 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0052000355037 LJ7 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0061000374466 TM2 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0073000381438 YJ4 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0029000237451 GS5 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0068000356055 TM9 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0033000302252 GS9 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0030000291660 GS6 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0065000351030 TM6 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0075000382757 YJ6 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0028000272295 GS4 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0012000363209 DQ4 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0076000379723 YJ7 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0048000345200 LJ3 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0036000298394 KM1 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0064000378036 TM5 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0043000314956 KM8 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0050000330475 LJ5 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0013000375336 DQ5 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0077000375053 YJ8 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0015000370666 DQ7 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0007000302025 Dingo G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0045000308782 LJ10 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0042000358772 KM7 S CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0018000304639 FAMBBEM00001 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0078000380805 YJ9 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0034000448223 ISW G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0040000309911 KM5 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0021000352410 FAMICHN00001 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0005000444143 CHW G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0016000371163 DQ8 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0041000347287 KM6 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
snp_cf0017000381122 DQ9 G CTCCTCCGGGATTTGAACCCGGGACCTCTC CACCCAAAGCGAGAATCATACCCCTAGACC 2014-07-19 2014-07-19
6.Fasta Information
GGGGGGAAGG AAAAAGCGGG CTCCTCCGGG ATTTGAACCC GGGACCTCTC
G
CACCCAAAGC GAGAATCATA CCCCTAGACC AACGAGCCCT CCGGGGCCTC