e.g. 1:1246..9423
SNP Detail For snp_cf0014000359670    [See in GBrowse]
1.General Information
SNP ID: snp_cf0014000359670
Organism: Canis familiaris
Individual: DQ6
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA
3'flank: TCTGTAATCTGCGTCTGCCTGGGGGCGTTG
3.Reference Map information
Chrom Position Reference DQ6
Chr11 388973 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000012915 154351 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000020494 1403 AAT => AGT ENSCAFP00000019020 468 N => S
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0044000325054 KM9 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0057000457386 LUPWRUS00002 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0019000287005 FAMBGSD00001 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0026000286401 GS2 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0009000370122 DQ1 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0024000312635 GS10 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0056000475314 LUPWRUS00001 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0027000284477 GS3 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0063000370397 TM4 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0051000364942 LJ6 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0004000302295 Basenji G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0059000374014 TM10 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0066000376009 TM7 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0067000362936 TM8 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0060000375801 TM1 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0070000389853 YJ1 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0047000342423 LJ2 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0049000375019 LJ4 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0074000375423 YJ5 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0010000370537 DQ2 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0053000362318 LJ8 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0054000328101 LJ9 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0008000362538 DQ10 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0039000287857 KM4 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0071000374508 YJ2 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0046000336025 LJ1 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0023000339894 FAMICHN00003 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0011000372638 DQ3 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0055000469673 LUPWCHN00001 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0025000271385 GS1 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0006000426840 CRW G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0028000272297 GS4 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0069000380721 YJ10 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0001000194068 solidGW1 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-08-01 2014-08-01
snp_cf0038000293764 KM3 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0020000366413 FAMBTIM00001 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0062000373719 TM3 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0037000314183 KM2 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0052000355039 LJ7 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0012000363211 DQ4 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0031000293678 GS7 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0073000381440 YJ4 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0058000470158 LUPWRUS00003 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0035000348954 KM10 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0032000273852 GS8 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0061000374468 TM2 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0016000371165 DQ8 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0029000237453 GS5 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0068000356057 TM9 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0033000302254 GS9 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0030000291662 GS6 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0065000351032 TM6 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0075000382759 YJ6 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0072000381570 YJ3 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0048000345202 LJ3 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0013000375338 DQ5 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0036000298396 KM1 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0050000330477 LJ5 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0064000378038 TM5 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0076000379725 YJ7 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0043000314958 KM8 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0077000375055 YJ8 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0018000304641 FAMBBEM00001 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0015000370668 DQ7 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0045000308784 LJ10 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0007000302027 Dingo G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0078000380807 YJ9 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0034000448225 ISW G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0021000352412 FAMICHN00001 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0042000358774 KM7 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0017000381124 DQ9 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0040000309913 KM5 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0041000347289 KM6 G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
snp_cf0005000444145 CHW G GAGCCCTCCGGGGCCTCCGTGCTTGGTTCA TCTGTAATCTGCGTCTGCCTGGGGGCGTTG 2014-07-19 2014-07-19
6.Fasta Information
AATCATACCC CTAGACCAAC GAGCCCTCCG GGGCCTCCGT GCTTGGTTCA
G
TCTGTAATCT GCGTCTGCCT GGGGGCGTTG TCACTAACAG GAAACCTTAC