e.g. 1:1246..9423
SNP Detail For snp_cf0014000359825    [See in GBrowse]
1.General Information
SNP ID: snp_cf0014000359825
Organism: Canis familiaris
Individual: DQ6
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: TTCACCTTGCTTCCTGACCAGGTCTTTATT
3'flank: AGCTTCTTATGAAAGTGAGAGCCCAGAGAA
3.Reference Map information
Chrom Position Reference DQ6
Chr11 1573374 G T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000391 53986 + G CDS
ENSCAFG00000000391 53986 + G intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000048461 1319 TGA => TTA ENSCAFP00000036021 440 stop_codon => L
+ ENSCAFT00000047085 1319 TGA => TTA ENSCAFP00000039759 440 stop_codon => L
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0013000375505 DQ5 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0057000458830 LUPWRUS00002 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0054000328258 LJ9 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0041000347482 KM6 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0076000380289 YJ7 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0008000362721 DQ10 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0053000362874 LJ8 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0010000370695 DQ2 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0024000312799 GS10 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0009000370282 DQ1 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0062000375508 TM3 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0020000366602 FAMBTIM00001 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0027000285003 GS3 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0030000291841 GS6 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0015000370835 DQ7 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0028000272393 GS4 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0068000356226 TM9 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0051000365556 LJ6 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0022000337272 FAMICHN00002 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0066000376404 TM7 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0040000310507 KM5 K TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0073000382300 YJ4 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0072000381763 YJ3 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0033000302827 GS9 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0052000355244 LJ7 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0046000336447 LJ1 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0071000374707 YJ2 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0025000271545 GS1 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0055000470240 LUPWCHN00001 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0056000475943 LUPWRUS00001 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0018000305150 FAMBBEM00001 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0019000287175 FAMBGSD00001 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0016000371657 DQ8 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0075000383398 YJ6 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0070000390444 YJ1 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0047000343026 LJ2 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0011000373209 DQ3 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0074000375971 YJ5 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0036000298920 KM1 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0061000374663 TM2 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0067000363250 TM8 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0029000237972 GS5 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0039000288412 KM4 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0069000381304 YJ10 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0065000351198 TM6 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0064000378190 TM5 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0032000274031 GS8 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0078000381509 YJ9 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0044000325389 KM9 K TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0035000349559 KM10 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0050000331044 LJ5 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0037000314715 KM2 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0077000375617 YJ8 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0023000340048 FAMICHN00003 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0058000471696 LUPWRUS00003 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0006000427396 CRW T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0005000445945 CHW T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0007000302537 Dingo T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0038000294310 KM3 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0059000374176 TM10 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0034000449624 ISW T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0049000375194 LJ4 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0060000377236 TM1 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0043000315529 KM8 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0063000370588 TM4 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0004000302444 Basenji T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0012000364642 DQ4 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0042000358972 KM7 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0017000381768 DQ9 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0048000345718 LJ3 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0021000352575 FAMICHN00001 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0031000293779 GS7 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0026000286580 GS2 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
snp_cf0045000309472 LJ10 T TTCACCTTGCTTCCTGACCAGGTCTTTATT AGCTTCTTATGAAAGTGAGAGCCCAGAGAA 2014-07-19 2014-07-19
6.Fasta Information
TCGCTGACCA TAACTGTAAT TTCACCTTGC TTCCTGACCA GGTCTTTATT
T
AGCTTCTTAT GAAAGTGAGA GCCCAGAGAA CCAAACAGAA AAAGAGAGGT