e.g. 1:1246..9423
SNP Detail For snp_cf0014001678609    [See in GBrowse]
1.General Information
SNP ID: snp_cf0014001678609
Organism: Canis familiaris
Individual: DQ6
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: CCTGGCCTAATTAGGTCCAGCTGGGTGAAA
3'flank: GTTCAGCGCAGGGGTGTCCAGAGTCTCACT
3.Reference Map information
Chrom Position Reference DQ6
Chr20 591723 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003813 4207 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000006137 131 ACG => ATG ENSCAFP00000005681 44 T => M
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0058002140042 LUPWRUS00003 Y CCTGGCCTAATTAGGTCCAGCTGGGTGAAA GTTCAGCGCAGGGGTGTCCAGAGTCTCACT 2014-07-19 2014-07-19
snp_cf0068001665628 TM9 Y CCTGGCCTAATTAGGTCCAGCTGGGTGAAA GTTCAGCGCAGGGGTGTCCAGAGTCTCACT 2014-07-19 2014-07-19
snp_cf0065001689769 TM6 Y CCTGGCCTAATTAGGTCCAGCTGGGTGAAA GTTCAGCGCAGGGGTGTCCAGAGTCTCACT 2014-07-19 2014-07-19
snp_cf0056002161886 LUPWRUS00001 Y CCTGGCCTAATTAGGTCCAGCTGGGTGAAA GTTCAGCGCAGGGGTGTCCAGAGTCTCACT 2014-07-19 2014-07-19
snp_cf0078001746319 YJ9 Y CCTGGCCTAATTAGGTCCAGCTGGGTGAAA GTTCAGCGCAGGGGTGTCCAGAGTCTCACT 2014-07-19 2014-07-19
snp_cf0053001658829 LJ8 Y CCTGGCCTAATTAGGTCCAGCTGGGTGAAA GTTCAGCGCAGGGGTGTCCAGAGTCTCACT 2014-07-19 2014-07-19
snp_cf0010001685401 DQ2 Y CCTGGCCTAATTAGGTCCAGCTGGGTGAAA GTTCAGCGCAGGGGTGTCCAGAGTCTCACT 2014-07-19 2014-07-19
snp_cf0073001702392 YJ4 Y CCTGGCCTAATTAGGTCCAGCTGGGTGAAA GTTCAGCGCAGGGGTGTCCAGAGTCTCACT 2014-07-19 2014-07-19
snp_cf0047001654577 LJ2 Y CCTGGCCTAATTAGGTCCAGCTGGGTGAAA GTTCAGCGCAGGGGTGTCCAGAGTCTCACT 2014-07-19 2014-07-19
snp_cf0004001434890 Basenji T CCTGGCCTAATTAGGTCCAGCTGGGTGAAA GTTCAGCGCAGGGGTGTCCAGAGTCTCACT 2014-07-19 2014-07-19
snp_cf0015001706725 DQ7 Y CCTGGCCTAATTAGGTCCAGCTGGGTGAAA GTTCAGCGCAGGGGTGTCCAGAGTCTCACT 2014-07-19 2014-07-19
snp_cf0064001718487 TM5 Y CCTGGCCTAATTAGGTCCAGCTGGGTGAAA GTTCAGCGCAGGGGTGTCCAGAGTCTCACT 2014-07-19 2014-07-19
snp_cf0067001678308 TM8 Y CCTGGCCTAATTAGGTCCAGCTGGGTGAAA GTTCAGCGCAGGGGTGTCCAGAGTCTCACT 2014-07-19 2014-07-19
snp_cf0066001743379 TM7 T CCTGGCCTAATTAGGTCCAGCTGGGTGAAA GTTCAGCGCAGGGGTGTCCAGAGTCTCACT 2014-07-19 2014-07-19
snp_cf0061001733298 TM2 Y CCTGGCCTAATTAGGTCCAGCTGGGTGAAA GTTCAGCGCAGGGGTGTCCAGAGTCTCACT 2014-07-19 2014-07-19
snp_cf0059001700852 TM10 Y CCTGGCCTAATTAGGTCCAGCTGGGTGAAA GTTCAGCGCAGGGGTGTCCAGAGTCTCACT 2014-07-19 2014-07-19
snp_cf0017001727100 DQ9 Y CCTGGCCTAATTAGGTCCAGCTGGGTGAAA GTTCAGCGCAGGGGTGTCCAGAGTCTCACT 2014-07-19 2014-07-19
snp_cf0062001712863 TM3 T CCTGGCCTAATTAGGTCCAGCTGGGTGAAA GTTCAGCGCAGGGGTGTCCAGAGTCTCACT 2014-07-19 2014-07-19
snp_cf0050001584074 LJ5 Y CCTGGCCTAATTAGGTCCAGCTGGGTGAAA GTTCAGCGCAGGGGTGTCCAGAGTCTCACT 2014-07-19 2014-07-19
snp_cf0074001725595 YJ5 Y CCTGGCCTAATTAGGTCCAGCTGGGTGAAA GTTCAGCGCAGGGGTGTCCAGAGTCTCACT 2014-07-19 2014-07-19
snp_cf0045001537692 LJ10 Y CCTGGCCTAATTAGGTCCAGCTGGGTGAAA GTTCAGCGCAGGGGTGTCCAGAGTCTCACT 2014-07-19 2014-07-19
snp_cf0075001748070 YJ6 Y CCTGGCCTAATTAGGTCCAGCTGGGTGAAA GTTCAGCGCAGGGGTGTCCAGAGTCTCACT 2014-07-19 2014-07-19
snp_cf0049001722202 LJ4 Y CCTGGCCTAATTAGGTCCAGCTGGGTGAAA GTTCAGCGCAGGGGTGTCCAGAGTCTCACT 2014-07-19 2014-07-19
6.Fasta Information
CTCAACACCC TGATGCAGGT CCTGGCCTAA TTAGGTCCAG CTGGGTGAAA
Y
GTTCAGCGCA GGGGTGTCCA GAGTCTCACT CCAGATGAGA AGAGTACTAC