e.g. 1:1246..9423
SNP Detail For snp_cf0014001679495    [See in GBrowse]
1.General Information
SNP ID: snp_cf0014001679495
Organism: Canis familiaris
Individual: DQ6
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs22931161  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC
3'flank: GCCTCCGCTGCTGCTGCTGCCGCTACTGCT
3.Reference Map information
Chrom Position Reference DQ6
Chr20 1143184 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003989 44 + T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000006429 44 CTG => CCG ENSCAFP00000005952 15 L => P
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0024001360566 GS10 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0005002031144 CHW C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0078001747096 YJ9 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0016001712332 DQ8 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0040001516826 KM5 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0057002053574 LUPWRUS00002 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0037001445158 KM2 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0067001679051 TM8 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0041001725564 KM6 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0026001313636 GS2 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0020001695715 FAMBTIM00001 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0011001734369 DQ3 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0017001727964 DQ9 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0028001275509 GS4 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0049001722975 LJ4 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0010001686281 DQ2 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0033001343828 GS9 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0029001230782 GS5 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0056002163149 LUPWRUS00001 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0039001411370 KM4 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0007001470465 Dingo C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0036001342446 KM1 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0066001744125 TM7 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0001000762420 solidGW1 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-08-01 2014-08-01
snp_cf0006001977160 CRW C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0062001713622 TM3 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0031001336417 GS7 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0065001690644 TM6 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0027001339701 GS3 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0009001710114 DQ1 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0060001679708 TM1 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0030001325721 GS6 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0073001703263 YJ4 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0019001305907 FAMBGSD00001 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0075001748953 YJ6 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0015001706859 DQ7 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0070001807594 YJ1 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0061001734170 TM2 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0012001693935 DQ4 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0003000957377 dbSNP139 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0023001603119 FAMICHN00003 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0038001352274 KM3 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0055002135826 LUPWCHN00001 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0008001706129 DQ10 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0074001726201 YJ5 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0042001787004 KM7 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0052001667816 LJ7 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0058002141161 LUPWRUS00003 Y GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0021001626741 FAMICHN00001 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0071001743485 YJ2 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0018001439006 FAMBBEM00001 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0068001666511 TM9 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0025001331864 GS1 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0076001761696 YJ7 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0044001508633 KM9 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0064001719327 TM5 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0035001657434 KM10 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0059001701725 TM10 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0077001734786 YJ8 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0013001629511 DQ5 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0032001311568 GS8 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0072001754945 YJ3 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0069001766584 YJ10 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0063001683047 TM4 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
snp_cf0043001436576 KM8 C GTCTGAGCCTGCGGGTGCTCCTGCCGCCGC GCCTCCGCTGCTGCTGCTGCCGCTACTGCT 2014-07-19 2014-07-19
6.Fasta Information
GCCCGTCATG CCACTGCCAC GTCTGAGCCT GCGGGTGCTC CTGCCGCCGC
C
GCCTCCGCTG CTGCTGCTGC CGCTACTGCT GCTGCTGCTG CTCAGGGGCG