e.g. 1:1246..9423
SNP Detail For snp_cf0014001681055    [See in GBrowse]
1.General Information
SNP ID: snp_cf0014001681055
Organism: Canis familiaris
Individual: DQ6
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: AAAGTTAATCGTCCTGTGAATCCCCACCAG
3'flank: CTGGAGGACAGTATAGTCCCAACACACAAG
3.Reference Map information
Chrom Position Reference DQ6
Chr20 3171050 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000004350 34358 - G intron
ENSCAFG00000004347 65029 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000006975 2443 GCT => ACT ENSCAFP00000006457 815 A => T
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0010001687678 DQ2 R AAAGTTAATCGTCCTGTGAATCCCCACCAG CTGGAGGACAGTATAGTCCCAACACACAAG 2014-07-19 2014-07-19
snp_cf0012001695248 DQ4 A AAAGTTAATCGTCCTGTGAATCCCCACCAG CTGGAGGACAGTATAGTCCCAACACACAAG 2014-07-19 2014-07-19
snp_cf0007001471774 Dingo A AAAGTTAATCGTCCTGTGAATCCCCACCAG CTGGAGGACAGTATAGTCCCAACACACAAG 2014-07-19 2014-07-19
snp_cf0009001711422 DQ1 A AAAGTTAATCGTCCTGTGAATCCCCACCAG CTGGAGGACAGTATAGTCCCAACACACAAG 2014-07-19 2014-07-19
6.Fasta Information
AATCTGTGCC AGCACCTGGG AAAGTTAATC GTCCTGTGAA TCCCCACCAG
R
CTGGAGGACA GTATAGTCCC AACACACAAG GAGGTAATAA CTCAGTCACA