e.g. 1:1246..9423
SNP Detail For snp_cf0015000370667    [See in GBrowse]
1.General Information
SNP ID: snp_cf0015000370667
Organism: Canis familiaris
Individual: DQ7
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: ATCATACCCCTAGACCAACGAGCCCTCCGG
3'flank: GCCTCCGTGCTTGGTTCAATCTGTAATCTG
3.Reference Map information
Chrom Position Reference DQ7
Chr11 388954 G T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000012915 154332 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000020494 1384 GGC => TGC ENSCAFP00000019020 462 G => C
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0019000287004 FAMBGSD00001 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0053000362317 LJ8 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0009000370121 DQ1 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0026000286400 GS2 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0057000457385 LUPWRUS00002 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0024000312634 GS10 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0044000325053 KM9 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0063000370396 TM4 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0056000475313 LUPWRUS00001 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0027000284476 GS3 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0070000389852 YJ1 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0051000364941 LJ6 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0047000342422 LJ2 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0060000375800 TM1 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0066000376008 TM7 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0049000375018 LJ4 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0067000362935 TM8 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0059000374013 TM10 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0014000359669 DQ6 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0074000375422 YJ5 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0004000302294 Basenji T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0010000370536 DQ2 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0072000381569 YJ3 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0054000328100 LJ9 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0046000336024 LJ1 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0020000366412 FAMBTIM00001 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0071000374507 YJ2 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0001000194067 solidGW1 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-08-01 2014-08-01
snp_cf0023000339893 FAMICHN00003 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0039000287856 KM4 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0008000362537 DQ10 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0055000469672 LUPWCHN00001 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0031000293677 GS7 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0038000293763 KM3 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0069000380720 YJ10 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0062000373718 TM3 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0025000271384 GS1 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0002000240118 CID1 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-08-02 2014-08-02
snp_cf0052000355038 LJ7 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0012000363210 DQ4 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0037000314182 KM2 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0006000426839 CRW T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0011000372637 DQ3 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0058000470157 LUPWRUS00003 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0032000273851 GS8 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0035000348953 KM10 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0061000374467 TM2 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0016000371164 DQ8 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0073000381439 YJ4 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0068000356056 TM9 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0029000237452 GS5 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0033000302253 GS9 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0030000291661 GS6 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0065000351031 TM6 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0075000382758 YJ6 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0028000272296 GS4 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0018000304640 FAMBBEM00001 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0048000345201 LJ3 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0036000298395 KM1 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0064000378037 TM5 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0050000330476 LJ5 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0013000375337 DQ5 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0077000375054 YJ8 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0043000314957 KM8 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0076000379724 YJ7 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0045000308783 LJ10 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0007000302026 Dingo T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0034000448224 ISW T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0021000352411 FAMICHN00001 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0042000358773 KM7 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0078000380806 YJ9 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0005000444144 CHW T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0040000309912 KM5 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0017000381123 DQ9 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
snp_cf0041000347288 KM6 T ATCATACCCCTAGACCAACGAGCCCTCCGG GCCTCCGTGCTTGGTTCAATCTGTAATCTG 2014-07-19 2014-07-19
6.Fasta Information
CTCTCCCACC CAAAGCGAGA ATCATACCCC TAGACCAACG AGCCCTCCGG
T
GCCTCCGTGC TTGGTTCAAT CTGTAATCTG CGTCTGCCTG GGGGCGTTGT