e.g. 1:1246..9423
SNP Detail For snp_cf0015000370676    [See in GBrowse]
1.General Information
SNP ID: snp_cf0015000370676
Organism: Canis familiaris
Individual: DQ7
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: M
5'flank: TGGTCCAGGTGATTCGGCAGATGCACCCAA
3'flank: TCCTGGCCGAGGGAGCCGTGGGAGCGAGCA
3.Reference Map information
Chrom Position Reference DQ7
Chr11 417350 C M
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000012851 638 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000020424 638 ACT => AAT ENSCAFP00000018951 213 T => N
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0071000374513 YJ2 A TGGTCCAGGTGATTCGGCAGATGCACCCAA TCCTGGCCGAGGGAGCCGTGGGAGCGAGCA 2014-07-19 2014-07-19
snp_cf0061000374475 TM2 M TGGTCCAGGTGATTCGGCAGATGCACCCAA TCCTGGCCGAGGGAGCCGTGGGAGCGAGCA 2014-07-19 2014-07-19
snp_cf0011000372649 DQ3 M TGGTCCAGGTGATTCGGCAGATGCACCCAA TCCTGGCCGAGGGAGCCGTGGGAGCGAGCA 2014-07-19 2014-07-19
snp_cf0060000375830 TM1 M TGGTCCAGGTGATTCGGCAGATGCACCCAA TCCTGGCCGAGGGAGCCGTGGGAGCGAGCA 2014-07-19 2014-07-19
snp_cf0064000378044 TM5 M TGGTCCAGGTGATTCGGCAGATGCACCCAA TCCTGGCCGAGGGAGCCGTGGGAGCGAGCA 2014-07-19 2014-07-19
snp_cf0006000426855 CRW M TGGTCCAGGTGATTCGGCAGATGCACCCAA TCCTGGCCGAGGGAGCCGTGGGAGCGAGCA 2014-07-19 2014-07-19
snp_cf0013000375347 DQ5 M TGGTCCAGGTGATTCGGCAGATGCACCCAA TCCTGGCCGAGGGAGCCGTGGGAGCGAGCA 2014-07-19 2014-07-19
snp_cf0062000373783 TM3 M TGGTCCAGGTGATTCGGCAGATGCACCCAA TCCTGGCCGAGGGAGCCGTGGGAGCGAGCA 2014-07-19 2014-07-19
snp_cf0047000342434 LJ2 M TGGTCCAGGTGATTCGGCAGATGCACCCAA TCCTGGCCGAGGGAGCCGTGGGAGCGAGCA 2014-07-19 2014-07-19
snp_cf0072000381578 YJ3 M TGGTCCAGGTGATTCGGCAGATGCACCCAA TCCTGGCCGAGGGAGCCGTGGGAGCGAGCA 2014-07-19 2014-07-19
snp_cf0009000370129 DQ1 M TGGTCCAGGTGATTCGGCAGATGCACCCAA TCCTGGCCGAGGGAGCCGTGGGAGCGAGCA 2014-07-19 2014-07-19
snp_cf0052000355048 LJ7 M TGGTCCAGGTGATTCGGCAGATGCACCCAA TCCTGGCCGAGGGAGCCGTGGGAGCGAGCA 2014-07-19 2014-07-19
6.Fasta Information
CAACCTGCAG CTGGCCAACA TGGTCCAGGT GATTCGGCAG ATGCACCCAA
M
TCCTGGCCGA GGGAGCCGTG GGAGCGAGCA GGGCATTTGT CCAAAACACC