e.g. 1:1246..9423
SNP Detail For snp_cf0015000370756    [See in GBrowse]
1.General Information
SNP ID: snp_cf0015000370756
Organism: Canis familiaris
Individual: DQ7
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: TGGCTCTGCCTCGGACTGCTCGACGGCGAG
3'flank: GCGGCGAGGCCGGGCGGGGCGCGGCGGGGC
3.Reference Map information
Chrom Position Reference DQ7
Chr11 1145762 A T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000482 137 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000047300 64 AGC => TGC ENSCAFP00000036790 22 S => C
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0024000312712 GS10 T TGGCTCTGCCTCGGACTGCTCGACGGCGAG GCGGCGAGGCCGGGCGGGGCGCGGCGGGGC 2014-07-19 2014-07-19
snp_cf0012000364280 DQ4 T TGGCTCTGCCTCGGACTGCTCGACGGCGAG GCGGCGAGGCCGGGCGGGGCGCGGCGGGGC 2014-07-19 2014-07-19
snp_cf0061000374570 TM2 T TGGCTCTGCCTCGGACTGCTCGACGGCGAG GCGGCGAGGCCGGGCGGGGCGCGGCGGGGC 2014-07-19 2014-07-19
snp_cf0035000349184 KM10 T TGGCTCTGCCTCGGACTGCTCGACGGCGAG GCGGCGAGGCCGGGCGGGGCGCGGCGGGGC 2014-07-19 2014-07-19
snp_cf0069000380932 YJ10 T TGGCTCTGCCTCGGACTGCTCGACGGCGAG GCGGCGAGGCCGGGCGGGGCGCGGCGGGGC 2014-07-19 2014-07-19
snp_cf0063000370497 TM4 T TGGCTCTGCCTCGGACTGCTCGACGGCGAG GCGGCGAGGCCGGGCGGGGCGCGGCGGGGC 2014-07-19 2014-07-19
snp_cf0068000356140 TM9 T TGGCTCTGCCTCGGACTGCTCGACGGCGAG GCGGCGAGGCCGGGCGGGGCGCGGCGGGGC 2014-07-19 2014-07-19
snp_cf0064000378112 TM5 T TGGCTCTGCCTCGGACTGCTCGACGGCGAG GCGGCGAGGCCGGGCGGGGCGCGGCGGGGC 2014-07-19 2014-07-19
snp_cf0075000383056 YJ6 T TGGCTCTGCCTCGGACTGCTCGACGGCGAG GCGGCGAGGCCGGGCGGGGCGCGGCGGGGC 2014-07-19 2014-07-19
snp_cf0062000375013 TM3 T TGGCTCTGCCTCGGACTGCTCGACGGCGAG GCGGCGAGGCCGGGCGGGGCGCGGCGGGGC 2014-07-19 2014-07-19
snp_cf0044000325249 KM9 T TGGCTCTGCCTCGGACTGCTCGACGGCGAG GCGGCGAGGCCGGGCGGGGCGCGGCGGGGC 2014-07-19 2014-07-19
snp_cf0055000469840 LUPWCHN00001 T TGGCTCTGCCTCGGACTGCTCGACGGCGAG GCGGCGAGGCCGGGCGGGGCGCGGCGGGGC 2014-07-19 2014-07-19
snp_cf0039000288057 KM4 T TGGCTCTGCCTCGGACTGCTCGACGGCGAG GCGGCGAGGCCGGGCGGGGCGCGGCGGGGC 2014-07-19 2014-07-19
snp_cf0065000351116 TM6 T TGGCTCTGCCTCGGACTGCTCGACGGCGAG GCGGCGAGGCCGGGCGGGGCGCGGCGGGGC 2014-07-19 2014-07-19
snp_cf0009000370201 DQ1 T TGGCTCTGCCTCGGACTGCTCGACGGCGAG GCGGCGAGGCCGGGCGGGGCGCGGCGGGGC 2014-07-19 2014-07-19
6.Fasta Information
CCGCGCTGTG CCTGCGCCTG TGGCTCTGCC TCGGACTGCT CGACGGCGAG
T
GCGGCGAGGC CGGGCGGGGC GCGGCGGGGC GCGGCGGGGC GCGGCGGGGC