e.g. 1:1246..9423
SNP Detail For snp_cf0015000370897    [See in GBrowse]
1.General Information
SNP ID: snp_cf0015000370897
Organism: Canis familiaris
Individual: DQ7
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC
3'flank: TGAGCTCCAGGCGCTCGGGCGACACGGCCT
3.Reference Map information
Chrom Position Reference DQ7
Chr11 1963682 A T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000350 52812 - A intron
ENSCAFG00000000350 52812 - A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000038429 155 ATG => AAG ENSCAFP00000034146 52 M => K
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0035000349622 KM10 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0017000382051 DQ9 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0026000286643 GS2 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0042000359041 KM7 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0040000310664 KM5 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0027000285051 GS3 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0041000347558 KM6 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0032000274094 GS8 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0063000370717 TM4 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0061000374729 TM2 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0066000376763 TM7 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0044000325445 KM9 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0065000351256 TM6 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0073000382539 YJ4 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0076000380412 YJ7 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0068000356280 TM9 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0016000372025 DQ8 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0043000315588 KM8 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0075000383557 YJ6 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0038000294376 KM3 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0049000375252 LJ4 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0078000381716 YJ9 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0072000381838 YJ3 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0071000374784 YJ2 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0021000352670 FAMICHN00001 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0036000298963 KM1 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0067000363599 TM8 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0070000390604 YJ1 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0055000470391 LUPWCHN00001 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0024000312857 GS10 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0010000370751 DQ2 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0030000291904 GS6 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0062000375925 TM3 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0060000377367 TM1 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0069000381500 YJ10 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0013000375565 DQ5 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0033000302892 GS9 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0052000355305 LJ7 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0059000374235 TM10 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0039000288466 KM4 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0046000336702 LJ1 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0012000364777 DQ4 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0025000271604 GS1 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0029000238014 GS5 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0014000359883 DQ6 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0077000375779 YJ8 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0028000272432 GS4 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0074000376091 YJ5 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0031000293819 GS7 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
snp_cf0037000314763 KM2 T CGCTGGTGCAGAGCGAAAGTGTGCTGGCGC TGAGCTCCAGGCGCTCGGGCGACACGGCCT 2014-07-19 2014-07-19
6.Fasta Information
NNNNNNNNNN NNNGATGCAG CGCTGGTGCA GAGCGAAAGT GTGCTGGCGC
T
TGAGCTCCAG GCGCTCGGGC GACACGGCCT CGTAGCGGGC CTCGCAGGTG